FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639413_at:

>probe:Drosophila_2:1639413_at:514:175; Interrogation_Position=102; Antisense; AAACCTTGAATCTTTTGGCACCTGT
>probe:Drosophila_2:1639413_at:566:729; Interrogation_Position=116; Antisense; TTGGCACCTGTTTCACAATTGTTGA
>probe:Drosophila_2:1639413_at:89:465; Interrogation_Position=136; Antisense; GTTGAAGCCCCTTCGAAGGCAAAGT
>probe:Drosophila_2:1639413_at:241:565; Interrogation_Position=153; Antisense; GGCAAAGTTCTTCGCGCGTAAACGC
>probe:Drosophila_2:1639413_at:620:325; Interrogation_Position=168; Antisense; GCGTAAACGCCCTTTTGATAAATGT
>probe:Drosophila_2:1639413_at:267:167; Interrogation_Position=187; Antisense; AAATGTTCCTAGAGTTCAGCTTTCT
>probe:Drosophila_2:1639413_at:104:461; Interrogation_Position=241; Antisense; GATTCACATGCACGGTTTAACTAGG
>probe:Drosophila_2:1639413_at:5:147; Interrogation_Position=259; Antisense; AACTAGGTTCGGCAGGACCATTGTA
>probe:Drosophila_2:1639413_at:216:243; Interrogation_Position=352; Antisense; AATTTGCGCCAAATGCCTGGGTGGA
>probe:Drosophila_2:1639413_at:604:387; Interrogation_Position=412; Antisense; GAAAATTTACGGGTGCTGCAAGACT
>probe:Drosophila_2:1639413_at:289:557; Interrogation_Position=466; Antisense; GGACATACTGCTGTCTTGGACCAAA
>probe:Drosophila_2:1639413_at:265:345; Interrogation_Position=496; Antisense; GCATTACAACATCATCTTGCCCAAA
>probe:Drosophila_2:1639413_at:612:703; Interrogation_Position=564; Antisense; TTATTTTTCCTAACTGCCCTGTTGG
>probe:Drosophila_2:1639413_at:39:39; Interrogation_Position=60; Antisense; ATCTAAATTCCAGTGCGTTTTCCTA

Paste this into a BLAST search page for me
AAACCTTGAATCTTTTGGCACCTGTTTGGCACCTGTTTCACAATTGTTGAGTTGAAGCCCCTTCGAAGGCAAAGTGGCAAAGTTCTTCGCGCGTAAACGCGCGTAAACGCCCTTTTGATAAATGTAAATGTTCCTAGAGTTCAGCTTTCTGATTCACATGCACGGTTTAACTAGGAACTAGGTTCGGCAGGACCATTGTAAATTTGCGCCAAATGCCTGGGTGGAGAAAATTTACGGGTGCTGCAAGACTGGACATACTGCTGTCTTGGACCAAAGCATTACAACATCATCTTGCCCAAATTATTTTTCCTAACTGCCCTGTTGGATCTAAATTCCAGTGCGTTTTCCTA

Full Affymetrix probeset data:

Annotations for 1639413_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720