Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639414_at:

>probe:Drosophila_2:1639414_at:688:661; Interrogation_Position=2753; Antisense; TAAAATCCCATTTCTTTTGTAGGAG
>probe:Drosophila_2:1639414_at:99:483; Interrogation_Position=2771; Antisense; GTAGGAGAAAGTGCAGCCGATATTC
>probe:Drosophila_2:1639414_at:650:317; Interrogation_Position=2786; Antisense; GCCGATATTCAAGCACAAAGCCTGA
>probe:Drosophila_2:1639414_at:138:205; Interrogation_Position=2803; Antisense; AAGCCTGAACGCACATGTTTTTCAT
>probe:Drosophila_2:1639414_at:254:705; Interrogation_Position=2919; Antisense; TTAGTTCAATGTAAAGGAGCGGCAC
>probe:Drosophila_2:1639414_at:54:555; Interrogation_Position=2934; Antisense; GGAGCGGCACTGTAAACTTCAAAGC
>probe:Drosophila_2:1639414_at:427:63; Interrogation_Position=2990; Antisense; ATGGGCATTCAAAGCAAACTGTTTT
>probe:Drosophila_2:1639414_at:143:663; Interrogation_Position=3014; Antisense; TAAAAGCTACATTTCAGTTGACATT
>probe:Drosophila_2:1639414_at:650:697; Interrogation_Position=3056; Antisense; TTTCAAGATTCGTAATGCTCCTCAT
>probe:Drosophila_2:1639414_at:220:657; Interrogation_Position=3068; Antisense; TAATGCTCCTCATCTATTCCGTGAG
>probe:Drosophila_2:1639414_at:143:9; Interrogation_Position=3083; Antisense; ATTCCGTGAGTCCTGTTGCTTTTGT
>probe:Drosophila_2:1639414_at:695:659; Interrogation_Position=3247; Antisense; TAAAACGCCTTTAAACAGCTTGAAT
>probe:Drosophila_2:1639414_at:174:155; Interrogation_Position=3261; Antisense; ACAGCTTGAATTGATCTCACTTTTA
>probe:Drosophila_2:1639414_at:252:699; Interrogation_Position=3309; Antisense; TTTATATAGGCTTCTCCATTTCAAA

Paste this into a BLAST search page for me
TAAAATCCCATTTCTTTTGTAGGAGGTAGGAGAAAGTGCAGCCGATATTCGCCGATATTCAAGCACAAAGCCTGAAAGCCTGAACGCACATGTTTTTCATTTAGTTCAATGTAAAGGAGCGGCACGGAGCGGCACTGTAAACTTCAAAGCATGGGCATTCAAAGCAAACTGTTTTTAAAAGCTACATTTCAGTTGACATTTTTCAAGATTCGTAATGCTCCTCATTAATGCTCCTCATCTATTCCGTGAGATTCCGTGAGTCCTGTTGCTTTTGTTAAAACGCCTTTAAACAGCTTGAATACAGCTTGAATTGATCTCACTTTTATTTATATAGGCTTCTCCATTTCAAA

Full Affymetrix probeset data:

Annotations for 1639414_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime