Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639415_at:

>probe:Drosophila_2:1639415_at:399:721; Interrogation_Position=2352; Antisense; TTGCTAACGTTCCACTACCGAGAGA
>probe:Drosophila_2:1639415_at:98:305; Interrogation_Position=2369; Antisense; CCGAGAGACGCCCAATCATCTGAGG
>probe:Drosophila_2:1639415_at:489:117; Interrogation_Position=2396; Antisense; AGCTATGGTTGACAAGGCGCGCTCC
>probe:Drosophila_2:1639415_at:608:69; Interrogation_Position=2410; Antisense; AGGCGCGCTCCTTGATCGAGAAGTA
>probe:Drosophila_2:1639415_at:611:109; Interrogation_Position=2428; Antisense; AGAAGTACGGCTTCAAGGCCACGGA
>probe:Drosophila_2:1639415_at:71:637; Interrogation_Position=2474; Antisense; TCGTCCGCCGGTGCAGTGGAATAAG
>probe:Drosophila_2:1639415_at:659:333; Interrogation_Position=2492; Antisense; GAATAAGGGTCGTGCCTCGATCTAC
>probe:Drosophila_2:1639415_at:83:149; Interrogation_Position=2526; Antisense; ACATCCTTCGGCGTGGACTGGAACG
>probe:Drosophila_2:1639415_at:387:681; Interrogation_Position=2618; Antisense; TATGGCGCGAACTTTCCGTGTGACA
>probe:Drosophila_2:1639415_at:450:459; Interrogation_Position=2649; Antisense; GATATTGTGAAGACCGCTGCGGATC
>probe:Drosophila_2:1639415_at:4:521; Interrogation_Position=2718; Antisense; GTGGAACGACACTTCATGGGACGCA
>probe:Drosophila_2:1639415_at:168:141; Interrogation_Position=2785; Antisense; ACGGTGTCCAGATGCAGATGTCCCT
>probe:Drosophila_2:1639415_at:257:513; Interrogation_Position=2843; Antisense; GTGAGCCCAGATATCCATGCATTAT
>probe:Drosophila_2:1639415_at:242:15; Interrogation_Position=2863; Antisense; ATTATCTATGCATGCCTCGTAACTC

Paste this into a BLAST search page for me
TTGCTAACGTTCCACTACCGAGAGACCGAGAGACGCCCAATCATCTGAGGAGCTATGGTTGACAAGGCGCGCTCCAGGCGCGCTCCTTGATCGAGAAGTAAGAAGTACGGCTTCAAGGCCACGGATCGTCCGCCGGTGCAGTGGAATAAGGAATAAGGGTCGTGCCTCGATCTACACATCCTTCGGCGTGGACTGGAACGTATGGCGCGAACTTTCCGTGTGACAGATATTGTGAAGACCGCTGCGGATCGTGGAACGACACTTCATGGGACGCAACGGTGTCCAGATGCAGATGTCCCTGTGAGCCCAGATATCCATGCATTATATTATCTATGCATGCCTCGTAACTC

Full Affymetrix probeset data:

Annotations for 1639415_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime