FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639416_at:

>probe:Drosophila_2:1639416_at:385:105; Interrogation_Position=1009; Antisense; AGACTTCCACGTAACCAAGTTGCCG
>probe:Drosophila_2:1639416_at:168:253; Interrogation_Position=1024; Antisense; CAAGTTGCCGCTCCTCGAGAAAGAG
>probe:Drosophila_2:1639416_at:457:101; Interrogation_Position=1062; Antisense; AGAGCATCCGTTCTTTCTCCGAGAA
>probe:Drosophila_2:1639416_at:226:663; Interrogation_Position=1210; Antisense; TAAAGTTGAGGCAGCGATCCCCGAA
>probe:Drosophila_2:1639416_at:260:223; Interrogation_Position=1233; Antisense; AAGGGATCTGCTTCGACGTGTAATG
>probe:Drosophila_2:1639416_at:63:569; Interrogation_Position=698; Antisense; GGCATGGCTGATGTGAACGCTGACA
>probe:Drosophila_2:1639416_at:323:587; Interrogation_Position=738; Antisense; TGGACGACATGCTGCGCGTTATCAC
>probe:Drosophila_2:1639416_at:277:683; Interrogation_Position=757; Antisense; TATCACCCAGGTCAACGAGCAGTTC
>probe:Drosophila_2:1639416_at:187:179; Interrogation_Position=795; Antisense; AAACTACATTCGTCTGCGTGTGCAT
>probe:Drosophila_2:1639416_at:125:27; Interrogation_Position=818; Antisense; ATAGCAGAGTTCTTCTCGCTGTACG
>probe:Drosophila_2:1639416_at:237:103; Interrogation_Position=862; Antisense; AGAGCTAACCAAGTGCGGCATCGAC
>probe:Drosophila_2:1639416_at:289:347; Interrogation_Position=879; Antisense; GCATCGACGTCCACAACATCATTGT
>probe:Drosophila_2:1639416_at:71:621; Interrogation_Position=912; Antisense; TGCTGTTTCTGCAGAACTCGCACGA
>probe:Drosophila_2:1639416_at:185:627; Interrogation_Position=994; Antisense; TGCCGACCTGTATGAAGACTTCCAC

Paste this into a BLAST search page for me
AGACTTCCACGTAACCAAGTTGCCGCAAGTTGCCGCTCCTCGAGAAAGAGAGAGCATCCGTTCTTTCTCCGAGAATAAAGTTGAGGCAGCGATCCCCGAAAAGGGATCTGCTTCGACGTGTAATGGGCATGGCTGATGTGAACGCTGACATGGACGACATGCTGCGCGTTATCACTATCACCCAGGTCAACGAGCAGTTCAAACTACATTCGTCTGCGTGTGCATATAGCAGAGTTCTTCTCGCTGTACGAGAGCTAACCAAGTGCGGCATCGACGCATCGACGTCCACAACATCATTGTTGCTGTTTCTGCAGAACTCGCACGATGCCGACCTGTATGAAGACTTCCAC

Full Affymetrix probeset data:

Annotations for 1639416_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720