FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639418_at:

>probe:Drosophila_2:1639418_at:231:507; Interrogation_Position=134; Antisense; GTGCCCGGCCGCAAAATGATGTGGA
>probe:Drosophila_2:1639418_at:447:639; Interrogation_Position=191; Antisense; TCGGCGGCTACAAGTTCAGCTACAA
>probe:Drosophila_2:1639418_at:523:329; Interrogation_Position=262; Antisense; GCGGGCACCGACAACGAATCCATAT
>probe:Drosophila_2:1639418_at:109:135; Interrogation_Position=332; Antisense; ACACCATTAACTTTGTGGCCGACGA
>probe:Drosophila_2:1639418_at:627:539; Interrogation_Position=361; Antisense; GGTTTTCAGCCGGAGGGTGCCCATC
>probe:Drosophila_2:1639418_at:540:85; Interrogation_Position=392; Antisense; AGTAGACCTCCGCTTTCGAGGAGAT
>probe:Drosophila_2:1639418_at:32:601; Interrogation_Position=419; Antisense; TGTAAATACCACCTTCCCGAATGAA
>probe:Drosophila_2:1639418_at:386:267; Interrogation_Position=470; Antisense; CAGTGAGGTGCTAAGGTCCTGTCCG
>probe:Drosophila_2:1639418_at:206:367; Interrogation_Position=51; Antisense; GAATCTGCAATTTCGAGAACCGCTC
>probe:Drosophila_2:1639418_at:211:291; Interrogation_Position=514; Antisense; CGTGGCAGCCAATCGGTCAGTCAGT
>probe:Drosophila_2:1639418_at:431:495; Interrogation_Position=553; Antisense; GTCAGTCAAGTCAGTGTCGTGCATT
>probe:Drosophila_2:1639418_at:240:501; Interrogation_Position=568; Antisense; GTCGTGCATTGTTTTCTATTTTCCT
>probe:Drosophila_2:1639418_at:27:279; Interrogation_Position=583; Antisense; CTATTTTCCTTGTTACTCGCATTAA
>probe:Drosophila_2:1639418_at:119:163; Interrogation_Position=85; Antisense; AAATTGATGCTAGTCGTTGGCTCGA

Paste this into a BLAST search page for me
GTGCCCGGCCGCAAAATGATGTGGATCGGCGGCTACAAGTTCAGCTACAAGCGGGCACCGACAACGAATCCATATACACCATTAACTTTGTGGCCGACGAGGTTTTCAGCCGGAGGGTGCCCATCAGTAGACCTCCGCTTTCGAGGAGATTGTAAATACCACCTTCCCGAATGAACAGTGAGGTGCTAAGGTCCTGTCCGGAATCTGCAATTTCGAGAACCGCTCCGTGGCAGCCAATCGGTCAGTCAGTGTCAGTCAAGTCAGTGTCGTGCATTGTCGTGCATTGTTTTCTATTTTCCTCTATTTTCCTTGTTACTCGCATTAAAAATTGATGCTAGTCGTTGGCTCGA

Full Affymetrix probeset data:

Annotations for 1639418_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720