FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639419_at:

>probe:Drosophila_2:1639419_at:357:405; Interrogation_Position=106; Antisense; GACTCAATCCGCCTGGTGAAGCGCT
>probe:Drosophila_2:1639419_at:420:303; Interrogation_Position=114; Antisense; CCGCCTGGTGAAGCGCTGCACAAAA
>probe:Drosophila_2:1639419_at:1:267; Interrogation_Position=16; Antisense; CAGTTCATTGGTAATTCTTAGTTAA
>probe:Drosophila_2:1639419_at:91:133; Interrogation_Position=175; Antisense; ACCGCCGTGGGCTTCGCCATCATGG
>probe:Drosophila_2:1639419_at:547:41; Interrogation_Position=205; Antisense; ATCGGCTTCTTCGTCAAGCTGATTC
>probe:Drosophila_2:1639419_at:324:207; Interrogation_Position=220; Antisense; AAGCTGATTCACATTCCCATTAACA
>probe:Drosophila_2:1639419_at:248:187; Interrogation_Position=241; Antisense; AACAACATCATCGTGGGATCCTAGA
>probe:Drosophila_2:1639419_at:217:43; Interrogation_Position=250; Antisense; ATCGTGGGATCCTAGAAAGCGGCAG
>probe:Drosophila_2:1639419_at:479:301; Interrogation_Position=280; Antisense; CCCCGGACCGGAAAGAGATTACATG
>probe:Drosophila_2:1639419_at:370:709; Interrogation_Position=298; Antisense; TTACATGTAGTTCACGATTCCACGC
>probe:Drosophila_2:1639419_at:48:465; Interrogation_Position=313; Antisense; GATTCCACGCGCATCTTTAGCGAAA
>probe:Drosophila_2:1639419_at:271:697; Interrogation_Position=328; Antisense; TTTAGCGAAATAAATGCCCCTTCTT
>probe:Drosophila_2:1639419_at:154:47; Interrogation_Position=341; Antisense; ATGCCCCTTCTTCGGATTTTATACA
>probe:Drosophila_2:1639419_at:435:397; Interrogation_Position=61; Antisense; GACAAGGTTGTCAAATTCGCCGAAC

Paste this into a BLAST search page for me
GACTCAATCCGCCTGGTGAAGCGCTCCGCCTGGTGAAGCGCTGCACAAAACAGTTCATTGGTAATTCTTAGTTAAACCGCCGTGGGCTTCGCCATCATGGATCGGCTTCTTCGTCAAGCTGATTCAAGCTGATTCACATTCCCATTAACAAACAACATCATCGTGGGATCCTAGAATCGTGGGATCCTAGAAAGCGGCAGCCCCGGACCGGAAAGAGATTACATGTTACATGTAGTTCACGATTCCACGCGATTCCACGCGCATCTTTAGCGAAATTTAGCGAAATAAATGCCCCTTCTTATGCCCCTTCTTCGGATTTTATACAGACAAGGTTGTCAAATTCGCCGAAC

Full Affymetrix probeset data:

Annotations for 1639419_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720