FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639420_at:

>probe:Drosophila_2:1639420_at:709:35; Interrogation_Position=1042; Antisense; ATCTTCTTCCGGCAATCGATGGATC
>probe:Drosophila_2:1639420_at:446:427; Interrogation_Position=1069; Antisense; GAGTACCCGTTCGTGGGCTACGAGT
>probe:Drosophila_2:1639420_at:617:85; Interrogation_Position=1091; Antisense; AGTGCGGCAGCTACCGGGAATTCGC
>probe:Drosophila_2:1639420_at:407:247; Interrogation_Position=1109; Antisense; AATTCGCCGCCGGATATTGCGATGG
>probe:Drosophila_2:1639420_at:565:293; Interrogation_Position=1128; Antisense; CGATGGCAACCGGAAGGCGCGCTTC
>probe:Drosophila_2:1639420_at:344:717; Interrogation_Position=1150; Antisense; TTCGGTATCCATTCGCAGAGGCGTG
>probe:Drosophila_2:1639420_at:263:507; Interrogation_Position=1172; Antisense; GTGCGCAGGGTAGCTTCTATTTCCG
>probe:Drosophila_2:1639420_at:386:69; Interrogation_Position=1225; Antisense; AGGCGTCAGACCAACTGGCTGAGCG
>probe:Drosophila_2:1639420_at:229:369; Interrogation_Position=1259; Antisense; GAATGTCGTCGAGCAAGGTCAGTCA
>probe:Drosophila_2:1639420_at:438:537; Interrogation_Position=1275; Antisense; GGTCAGTCAGGTTAGCCAAAGCCCC
>probe:Drosophila_2:1639420_at:31:99; Interrogation_Position=858; Antisense; AGATGCGCAGTTCGTCCAGGTACTT
>probe:Drosophila_2:1639420_at:214:571; Interrogation_Position=895; Antisense; GGCTCCTTGGGCACCAGTCTGAAGT
>probe:Drosophila_2:1639420_at:467:349; Interrogation_Position=950; Antisense; GCAGGGCGCCGCAAACGAATTGCAA
>probe:Drosophila_2:1639420_at:86:55; Interrogation_Position=997; Antisense; ATGCAAAATACCAATCCCGTTTCCT

Paste this into a BLAST search page for me
ATCTTCTTCCGGCAATCGATGGATCGAGTACCCGTTCGTGGGCTACGAGTAGTGCGGCAGCTACCGGGAATTCGCAATTCGCCGCCGGATATTGCGATGGCGATGGCAACCGGAAGGCGCGCTTCTTCGGTATCCATTCGCAGAGGCGTGGTGCGCAGGGTAGCTTCTATTTCCGAGGCGTCAGACCAACTGGCTGAGCGGAATGTCGTCGAGCAAGGTCAGTCAGGTCAGTCAGGTTAGCCAAAGCCCCAGATGCGCAGTTCGTCCAGGTACTTGGCTCCTTGGGCACCAGTCTGAAGTGCAGGGCGCCGCAAACGAATTGCAAATGCAAAATACCAATCCCGTTTCCT

Full Affymetrix probeset data:

Annotations for 1639420_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720