FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639421_at:

>probe:Drosophila_2:1639421_at:714:169; Interrogation_Position=429; Antisense; AAAGGTTCATTACCGATGGCTGCCG
>probe:Drosophila_2:1639421_at:373:67; Interrogation_Position=444; Antisense; ATGGCTGCCGTATATTGACGCACTC
>probe:Drosophila_2:1639421_at:188:533; Interrogation_Position=478; Antisense; GGTGGTCCTCAAGGCGCTGATTACA
>probe:Drosophila_2:1639421_at:675:217; Interrogation_Position=518; Antisense; AAGTCCTTCCACGTTTATGTGACGC
>probe:Drosophila_2:1639421_at:492:463; Interrogation_Position=602; Antisense; GATTGCACGCTCATTCTGGACTCAG
>probe:Drosophila_2:1639421_at:123:585; Interrogation_Position=642; Antisense; TGGAATCGGTGGACTTTGTGCTTGT
>probe:Drosophila_2:1639421_at:513:531; Interrogation_Position=692; Antisense; GGTGGCATTATCAACCGCATTGGCA
>probe:Drosophila_2:1639421_at:371:3; Interrogation_Position=710; Antisense; ATTGGCACCTACACCATGGGTCTGT
>probe:Drosophila_2:1639421_at:682:499; Interrogation_Position=729; Antisense; GTCTGTGCGCCCGTGAGATGAAGAA
>probe:Drosophila_2:1639421_at:335:667; Interrogation_Position=761; Antisense; TACGTTCTGGCCGAAAGCTTCAAGT
>probe:Drosophila_2:1639421_at:545:207; Interrogation_Position=775; Antisense; AAGCTTCAAGTTCAGCCGTCTGTAT
>probe:Drosophila_2:1639421_at:697:641; Interrogation_Position=793; Antisense; TCTGTATCCACTCAATCAGCGCGAT
>probe:Drosophila_2:1639421_at:685:123; Interrogation_Position=810; Antisense; AGCGCGATCTGCCAAACGAGTACAA
>probe:Drosophila_2:1639421_at:646:57; Interrogation_Position=858; Antisense; ATGTAAGCAAAGTGCACCCGCTGGT

Paste this into a BLAST search page for me
AAAGGTTCATTACCGATGGCTGCCGATGGCTGCCGTATATTGACGCACTCGGTGGTCCTCAAGGCGCTGATTACAAAGTCCTTCCACGTTTATGTGACGCGATTGCACGCTCATTCTGGACTCAGTGGAATCGGTGGACTTTGTGCTTGTGGTGGCATTATCAACCGCATTGGCAATTGGCACCTACACCATGGGTCTGTGTCTGTGCGCCCGTGAGATGAAGAATACGTTCTGGCCGAAAGCTTCAAGTAAGCTTCAAGTTCAGCCGTCTGTATTCTGTATCCACTCAATCAGCGCGATAGCGCGATCTGCCAAACGAGTACAAATGTAAGCAAAGTGCACCCGCTGGT

Full Affymetrix probeset data:

Annotations for 1639421_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720