FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639425_at:

>probe:Drosophila_2:1639425_at:125:617; Interrogation_Position=111; Antisense; TGCAAGCGGCTCGACTTTATTGTGA
>probe:Drosophila_2:1639425_at:643:373; Interrogation_Position=147; Antisense; GAAGTCTAGTCGCTTTTCCTGTTGC
>probe:Drosophila_2:1639425_at:115:607; Interrogation_Position=201; Antisense; TGATGGCCCACGTTTATATCCATGG
>probe:Drosophila_2:1639425_at:127:115; Interrogation_Position=243; Antisense; AGCAGGTGATTCGTAGCCTTTCCAA
>probe:Drosophila_2:1639425_at:669:433; Interrogation_Position=345; Antisense; GAGGTGGTTACTTGGTTCACGACAA
>probe:Drosophila_2:1639425_at:657:483; Interrogation_Position=391; Antisense; GTATGGAAGATCACAGGCCCTGGGA
>probe:Drosophila_2:1639425_at:185:379; Interrogation_Position=428; Antisense; GAAGCTGCCCGTGAGATATTGCAAC
>probe:Drosophila_2:1639425_at:171:459; Interrogation_Position=442; Antisense; GATATTGCAACCCATCTATACCGAT
>probe:Drosophila_2:1639425_at:494:303; Interrogation_Position=480; Antisense; CCGAATCTGGTGGAATGGAGCCCTA
>probe:Drosophila_2:1639425_at:574:547; Interrogation_Position=508; Antisense; GGATGTGTACTGACCAATATTTCTG
>probe:Drosophila_2:1639425_at:691:389; Interrogation_Position=539; Antisense; GAAACACTCACTATTGGCTCGACAT
>probe:Drosophila_2:1639425_at:90:17; Interrogation_Position=575; Antisense; ATTTTGGTCTTACGACTGTGTGCGC
>probe:Drosophila_2:1639425_at:362:407; Interrogation_Position=588; Antisense; GACTGTGTGCGCATTGCTTACGTAA
>probe:Drosophila_2:1639425_at:626:639; Interrogation_Position=85; Antisense; TCTTAAACCCGTTTGGCGGCCAATG

Paste this into a BLAST search page for me
TGCAAGCGGCTCGACTTTATTGTGAGAAGTCTAGTCGCTTTTCCTGTTGCTGATGGCCCACGTTTATATCCATGGAGCAGGTGATTCGTAGCCTTTCCAAGAGGTGGTTACTTGGTTCACGACAAGTATGGAAGATCACAGGCCCTGGGAGAAGCTGCCCGTGAGATATTGCAACGATATTGCAACCCATCTATACCGATCCGAATCTGGTGGAATGGAGCCCTAGGATGTGTACTGACCAATATTTCTGGAAACACTCACTATTGGCTCGACATATTTTGGTCTTACGACTGTGTGCGCGACTGTGTGCGCATTGCTTACGTAATCTTAAACCCGTTTGGCGGCCAATG

Full Affymetrix probeset data:

Annotations for 1639425_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720