FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639426_at:

>probe:Drosophila_2:1639426_at:319:53; Interrogation_Position=1009; Antisense; ATGAACTGGCGGACCGGGACCGATA
>probe:Drosophila_2:1639426_at:190:259; Interrogation_Position=1074; Antisense; CACTCCGGGCGATAACTCTGATGGG
>probe:Drosophila_2:1639426_at:515:603; Interrogation_Position=548; Antisense; TGATCCAGAGTAGAGGCGGCTCCTT
>probe:Drosophila_2:1639426_at:137:677; Interrogation_Position=610; Antisense; TATCGCGCGGGTTTTGGTAACTTAT
>probe:Drosophila_2:1639426_at:165:683; Interrogation_Position=632; Antisense; TATCCCGAGACTTCTGGTTTGGCAA
>probe:Drosophila_2:1639426_at:360:539; Interrogation_Position=647; Antisense; GGTTTGGCAACGAGTTCGCGCACAA
>probe:Drosophila_2:1639426_at:64:645; Interrogation_Position=677; Antisense; TCTACCGCGACGATCATGAGCTGAG
>probe:Drosophila_2:1639426_at:547:429; Interrogation_Position=742; Antisense; GAGTATCCACTCTTCTGGCTAGACA
>probe:Drosophila_2:1639426_at:282:491; Interrogation_Position=800; Antisense; GTGAATTCCGTGGTTCACTACCGGA
>probe:Drosophila_2:1639426_at:364:411; Interrogation_Position=823; Antisense; GACGCTCTGGAGCAGCACAATCGGA
>probe:Drosophila_2:1639426_at:491:543; Interrogation_Position=849; Antisense; GGATTTCAGCACTTACGATCGGCGA
>probe:Drosophila_2:1639426_at:181:165; Interrogation_Position=886; Antisense; AAATCGGCAGATTCCACCTGTGGCG
>probe:Drosophila_2:1639426_at:113:591; Interrogation_Position=931; Antisense; TGGTTTGATCGCTGCACACAGTGCA
>probe:Drosophila_2:1639426_at:543:533; Interrogation_Position=973; Antisense; GGTGTCCACCAGAGAGCAAGTCCAG

Paste this into a BLAST search page for me
ATGAACTGGCGGACCGGGACCGATACACTCCGGGCGATAACTCTGATGGGTGATCCAGAGTAGAGGCGGCTCCTTTATCGCGCGGGTTTTGGTAACTTATTATCCCGAGACTTCTGGTTTGGCAAGGTTTGGCAACGAGTTCGCGCACAATCTACCGCGACGATCATGAGCTGAGGAGTATCCACTCTTCTGGCTAGACAGTGAATTCCGTGGTTCACTACCGGAGACGCTCTGGAGCAGCACAATCGGAGGATTTCAGCACTTACGATCGGCGAAAATCGGCAGATTCCACCTGTGGCGTGGTTTGATCGCTGCACACAGTGCAGGTGTCCACCAGAGAGCAAGTCCAG

Full Affymetrix probeset data:

Annotations for 1639426_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720