FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639427_at:

>probe:Drosophila_2:1639427_at:670:163; Interrogation_Position=1029; Antisense; AAATACTCAACATTGCCTCCGTACA
>probe:Drosophila_2:1639427_at:163:633; Interrogation_Position=1046; Antisense; TCCGTACATCCAGCAGTTGGCCAAA
>probe:Drosophila_2:1639427_at:476:169; Interrogation_Position=1069; Antisense; AAATGGCCAATATTTCGCCGCAAGT
>probe:Drosophila_2:1639427_at:120:301; Interrogation_Position=1084; Antisense; CGCCGCAAGTCGTGGAAATCTTTCT
>probe:Drosophila_2:1639427_at:677:163; Interrogation_Position=1099; Antisense; AAATCTTTCTGGAGCGGCAGCCCAA
>probe:Drosophila_2:1639427_at:426:503; Interrogation_Position=1165; Antisense; GTCCCGAACAGACCCAGGCCATGGA
>probe:Drosophila_2:1639427_at:49:559; Interrogation_Position=1187; Antisense; GGACACCCAGGTGCTCAAGGCCGTG
>probe:Drosophila_2:1639427_at:460:113; Interrogation_Position=1213; Antisense; AGCACGCACTGAGCAACAACGATGA
>probe:Drosophila_2:1639427_at:316:159; Interrogation_Position=1228; Antisense; ACAACGATGATCTTCAGCGGCTAAT
>probe:Drosophila_2:1639427_at:86:1; Interrogation_Position=1255; Antisense; AGGCGTCCCAGGCACTTAAGTAGGC
>probe:Drosophila_2:1639427_at:336:71; Interrogation_Position=1276; Antisense; AGGCGGAATGTGTGACTAGTCTTAA
>probe:Drosophila_2:1639427_at:521:191; Interrogation_Position=1335; Antisense; AACTAGCTTAGTGATCTCATTTTGT
>probe:Drosophila_2:1639427_at:395:159; Interrogation_Position=918; Antisense; ACAAAGCCAATCCAGGTGACCACCA
>probe:Drosophila_2:1639427_at:243:261; Interrogation_Position=992; Antisense; CACGCCCAAGCTGATCATGCAAGAG

Paste this into a BLAST search page for me
AAATACTCAACATTGCCTCCGTACATCCGTACATCCAGCAGTTGGCCAAAAAATGGCCAATATTTCGCCGCAAGTCGCCGCAAGTCGTGGAAATCTTTCTAAATCTTTCTGGAGCGGCAGCCCAAGTCCCGAACAGACCCAGGCCATGGAGGACACCCAGGTGCTCAAGGCCGTGAGCACGCACTGAGCAACAACGATGAACAACGATGATCTTCAGCGGCTAATAGGCGTCCCAGGCACTTAAGTAGGCAGGCGGAATGTGTGACTAGTCTTAAAACTAGCTTAGTGATCTCATTTTGTACAAAGCCAATCCAGGTGACCACCACACGCCCAAGCTGATCATGCAAGAG

Full Affymetrix probeset data:

Annotations for 1639427_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720