FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639429_at:

>probe:Drosophila_2:1639429_at:473:305; Interrogation_Position=1321; Antisense; CCGGAATCCTGTGCTATGTGGCAAT
>probe:Drosophila_2:1639429_at:216:727; Interrogation_Position=1415; Antisense; TTGTCACTGTGACTACGTGCACTAT
>probe:Drosophila_2:1639429_at:501:681; Interrogation_Position=1437; Antisense; TATGCTCCCGTTTGCAGTGCGGACA
>probe:Drosophila_2:1639429_at:50:307; Interrogation_Position=1480; Antisense; CCTGCCATGCGGGATGTTCGGAAAG
>probe:Drosophila_2:1639429_at:8:507; Interrogation_Position=1547; Antisense; GTGCCTGGGCTCTTCAAGTTTGAAC
>probe:Drosophila_2:1639429_at:103:381; Interrogation_Position=1575; Antisense; GAACCAGAGTCCCAATTTGCTGTGG
>probe:Drosophila_2:1639429_at:331:501; Interrogation_Position=1614; Antisense; GTCGACTGCTTCAATGAGTTCCTTA
>probe:Drosophila_2:1639429_at:168:429; Interrogation_Position=1629; Antisense; GAGTTCCTTATCTTTCTGGGTGTAA
>probe:Drosophila_2:1639429_at:233:657; Interrogation_Position=1651; Antisense; TAATGTGCTTCCTTAAACTCGTGGG
>probe:Drosophila_2:1639429_at:92:491; Interrogation_Position=1684; Antisense; GTAAATCGACGAATCTGCTCCTAGC
>probe:Drosophila_2:1639429_at:543:623; Interrogation_Position=1711; Antisense; TGCGTTGCATGCCTCCAGATGAGAA
>probe:Drosophila_2:1639429_at:157:99; Interrogation_Position=1727; Antisense; AGATGAGAAGACCTTCGCCCTGGGA
>probe:Drosophila_2:1639429_at:137:717; Interrogation_Position=1803; Antisense; TTCGGCTGGCTGATAGACAACTACT
>probe:Drosophila_2:1639429_at:216:561; Interrogation_Position=1860; Antisense; GGAAACTGTTGGCTCTATGACACAA

Paste this into a BLAST search page for me
CCGGAATCCTGTGCTATGTGGCAATTTGTCACTGTGACTACGTGCACTATTATGCTCCCGTTTGCAGTGCGGACACCTGCCATGCGGGATGTTCGGAAAGGTGCCTGGGCTCTTCAAGTTTGAACGAACCAGAGTCCCAATTTGCTGTGGGTCGACTGCTTCAATGAGTTCCTTAGAGTTCCTTATCTTTCTGGGTGTAATAATGTGCTTCCTTAAACTCGTGGGGTAAATCGACGAATCTGCTCCTAGCTGCGTTGCATGCCTCCAGATGAGAAAGATGAGAAGACCTTCGCCCTGGGATTCGGCTGGCTGATAGACAACTACTGGAAACTGTTGGCTCTATGACACAA

Full Affymetrix probeset data:

Annotations for 1639429_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720