FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639430_at:

>probe:Drosophila_2:1639430_at:245:363; Interrogation_Position=267; Antisense; GAATTCGCAGTTCCGCAAACAGTTT
>probe:Drosophila_2:1639430_at:109:265; Interrogation_Position=286; Antisense; CAGTTTCAGGAAATGTGCGCCGCCA
>probe:Drosophila_2:1639430_at:222:17; Interrogation_Position=368; Antisense; ATTTCTACTACGAACTGGGCGTCCA
>probe:Drosophila_2:1639430_at:554:549; Interrogation_Position=399; Antisense; GGAGGTTTGTCTAGCTGCCAATCAC
>probe:Drosophila_2:1639430_at:534:201; Interrogation_Position=426; Antisense; AACCGGTGGACTTATGGAGCTGGAC
>probe:Drosophila_2:1639430_at:366:655; Interrogation_Position=467; Antisense; TAATCGCCGCCAGAGGTCAGAGTTC
>probe:Drosophila_2:1639430_at:507:495; Interrogation_Position=482; Antisense; GTCAGAGTTCAGTGCACCAGGAGAT
>probe:Drosophila_2:1639430_at:632:437; Interrogation_Position=514; Antisense; GAGGACATCCTAATGGCCGCTAAGA
>probe:Drosophila_2:1639430_at:635:691; Interrogation_Position=550; Antisense; TTTGGCAACGGCTTTGTGGTTCACA
>probe:Drosophila_2:1639430_at:621:217; Interrogation_Position=589; Antisense; AAGTACATAGTTCAGTCCATTCCCG
>probe:Drosophila_2:1639430_at:509:221; Interrogation_Position=697; Antisense; AAGGATTTGGGCTGGACCGACTATC
>probe:Drosophila_2:1639430_at:624:147; Interrogation_Position=716; Antisense; ACTATCGTGCTCAACAGTCACTGGA
>probe:Drosophila_2:1639430_at:108:621; Interrogation_Position=746; Antisense; TGCTCGGCGAAGGTCTCTGTTGGAT
>probe:Drosophila_2:1639430_at:342:445; Interrogation_Position=787; Antisense; GATGAGCCAGCCTATTGGTTTCCCA

Paste this into a BLAST search page for me
GAATTCGCAGTTCCGCAAACAGTTTCAGTTTCAGGAAATGTGCGCCGCCAATTTCTACTACGAACTGGGCGTCCAGGAGGTTTGTCTAGCTGCCAATCACAACCGGTGGACTTATGGAGCTGGACTAATCGCCGCCAGAGGTCAGAGTTCGTCAGAGTTCAGTGCACCAGGAGATGAGGACATCCTAATGGCCGCTAAGATTTGGCAACGGCTTTGTGGTTCACAAAGTACATAGTTCAGTCCATTCCCGAAGGATTTGGGCTGGACCGACTATCACTATCGTGCTCAACAGTCACTGGATGCTCGGCGAAGGTCTCTGTTGGATGATGAGCCAGCCTATTGGTTTCCCA

Full Affymetrix probeset data:

Annotations for 1639430_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720