Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639431_at:

>probe:Drosophila_2:1639431_at:507:525; Interrogation_Position=2157; Antisense; GGGCTTGTTCAAGGCTTACTGTTGC
>probe:Drosophila_2:1639431_at:9:167; Interrogation_Position=2219; Antisense; AAATGCCCCAACAATACCCATTATG
>probe:Drosophila_2:1639431_at:724:107; Interrogation_Position=2252; Antisense; AGAAGCGGTGTGTTGTCCACTTCGA
>probe:Drosophila_2:1639431_at:497:467; Interrogation_Position=2263; Antisense; GTTGTCCACTTCGATGTACTCAGAT
>probe:Drosophila_2:1639431_at:607:469; Interrogation_Position=2323; Antisense; GTTCACTTAGTGCAGCAACTTGCGA
>probe:Drosophila_2:1639431_at:387:351; Interrogation_Position=2334; Antisense; GCAGCAACTTGCGATAACCTACAAA
>probe:Drosophila_2:1639431_at:688:491; Interrogation_Position=2419; Antisense; GTAATACGAATAATGCGCCCTGTTA
>probe:Drosophila_2:1639431_at:400:233; Interrogation_Position=2430; Antisense; AATGCGCCCTGTTAAATGCAACAAG
>probe:Drosophila_2:1639431_at:326:239; Interrogation_Position=2491; Antisense; AATCATTTAGAGTTCGTGTGCGTTA
>probe:Drosophila_2:1639431_at:32:461; Interrogation_Position=2578; Antisense; GATTTAAATAGCGAACCCAGCCATA
>probe:Drosophila_2:1639431_at:609:165; Interrogation_Position=2603; Antisense; AAATCGGCTTGAACATTTGCGAAAC
>probe:Drosophila_2:1639431_at:573:453; Interrogation_Position=2640; Antisense; GATAAACTCCTCAAGCAAGATTCTC
>probe:Drosophila_2:1639431_at:174:111; Interrogation_Position=2653; Antisense; AGCAAGATTCTCAACTGGACAGCCC
>probe:Drosophila_2:1639431_at:617:141; Interrogation_Position=2666; Antisense; ACTGGACAGCCCCTCAAGAAATAAT

Paste this into a BLAST search page for me
GGGCTTGTTCAAGGCTTACTGTTGCAAATGCCCCAACAATACCCATTATGAGAAGCGGTGTGTTGTCCACTTCGAGTTGTCCACTTCGATGTACTCAGATGTTCACTTAGTGCAGCAACTTGCGAGCAGCAACTTGCGATAACCTACAAAGTAATACGAATAATGCGCCCTGTTAAATGCGCCCTGTTAAATGCAACAAGAATCATTTAGAGTTCGTGTGCGTTAGATTTAAATAGCGAACCCAGCCATAAAATCGGCTTGAACATTTGCGAAACGATAAACTCCTCAAGCAAGATTCTCAGCAAGATTCTCAACTGGACAGCCCACTGGACAGCCCCTCAAGAAATAAT

Full Affymetrix probeset data:

Annotations for 1639431_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime