FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639432_at:

>probe:Drosophila_2:1639432_at:31:407; Interrogation_Position=1057; Antisense; GACTGGGCTGGAAGATGCGCATCTC
>probe:Drosophila_2:1639432_at:70:237; Interrogation_Position=1083; Antisense; AATCAGCCGGCGCTGCAGAACAGTG
>probe:Drosophila_2:1639432_at:244:189; Interrogation_Position=1101; Antisense; AACAGTGGTCTCTGCGACATCGGAA
>probe:Drosophila_2:1639432_at:238:71; Interrogation_Position=1132; Antisense; AGGCGCGGCTCATTCGATGGGCCAA
>probe:Drosophila_2:1639432_at:679:337; Interrogation_Position=1199; Antisense; GCTCTCCGAGTGCATGATCCTTGGC
>probe:Drosophila_2:1639432_at:324:45; Interrogation_Position=1264; Antisense; ATCCGCTGGTGTTCTACCTGGTGCA
>probe:Drosophila_2:1639432_at:66:593; Interrogation_Position=1282; Antisense; TGGTGCACGTGCTCTGTTGGTTCCT
>probe:Drosophila_2:1639432_at:360:5; Interrogation_Position=1329; Antisense; ATTGTCCAGCATGGCTCGATGCCGT
>probe:Drosophila_2:1639432_at:312:433; Interrogation_Position=1346; Antisense; GATGCCGTTCCACAAGTTCGAGTTC
>probe:Drosophila_2:1639432_at:560:427; Interrogation_Position=1365; Antisense; GAGTTCGTCGTTGGCTGGCTGTTCA
>probe:Drosophila_2:1639432_at:454:603; Interrogation_Position=1384; Antisense; TGTTCAGAGAGCTGACCGGACCCTA
>probe:Drosophila_2:1639432_at:229:573; Interrogation_Position=1476; Antisense; GGCGGAGTGGCCTACGAACTGAACA
>probe:Drosophila_2:1639432_at:721:383; Interrogation_Position=1491; Antisense; GAACTGAACAGCCTCGCCAGCGATG
>probe:Drosophila_2:1639432_at:510:309; Interrogation_Position=1555; Antisense; CCACGTTAGAGCCTGCGGTAGTCAA

Paste this into a BLAST search page for me
GACTGGGCTGGAAGATGCGCATCTCAATCAGCCGGCGCTGCAGAACAGTGAACAGTGGTCTCTGCGACATCGGAAAGGCGCGGCTCATTCGATGGGCCAAGCTCTCCGAGTGCATGATCCTTGGCATCCGCTGGTGTTCTACCTGGTGCATGGTGCACGTGCTCTGTTGGTTCCTATTGTCCAGCATGGCTCGATGCCGTGATGCCGTTCCACAAGTTCGAGTTCGAGTTCGTCGTTGGCTGGCTGTTCATGTTCAGAGAGCTGACCGGACCCTAGGCGGAGTGGCCTACGAACTGAACAGAACTGAACAGCCTCGCCAGCGATGCCACGTTAGAGCCTGCGGTAGTCAA

Full Affymetrix probeset data:

Annotations for 1639432_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720