FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639433_at:

>probe:Drosophila_2:1639433_at:84:113; Interrogation_Position=1448; Antisense; AGCAACAGCAAGTGAGCTCCACCAG
>probe:Drosophila_2:1639433_at:325:415; Interrogation_Position=1531; Antisense; GAGCCCTCGTCCAAGAAATTCCTAG
>probe:Drosophila_2:1639433_at:722:161; Interrogation_Position=1546; Antisense; AAATTCCTAGCTGGCGCCATCGAAA
>probe:Drosophila_2:1639433_at:322:43; Interrogation_Position=1564; Antisense; ATCGAAAAGTCGAGCTCCGCTTGGA
>probe:Drosophila_2:1639433_at:524:439; Interrogation_Position=1587; Antisense; GAGGCCGTGGTAGATCAACCGCACA
>probe:Drosophila_2:1639433_at:44:269; Interrogation_Position=1610; Antisense; CAGGCCACTTCTATGTTACGTTTAT
>probe:Drosophila_2:1639433_at:669:453; Interrogation_Position=1670; Antisense; GATCACTTCAATGCTTTAGAACCCC
>probe:Drosophila_2:1639433_at:598:667; Interrogation_Position=1686; Antisense; TAGAACCCCATTAAGTTTCAACGAT
>probe:Drosophila_2:1639433_at:217:681; Interrogation_Position=1716; Antisense; TATGTTTTTATGTATCCCCGTTTCG
>probe:Drosophila_2:1639433_at:169:719; Interrogation_Position=1737; Antisense; TTCGCTTTCTTCATTTTAAGTTCAG
>probe:Drosophila_2:1639433_at:185:513; Interrogation_Position=1783; Antisense; GTGTAGTTCTCGTTTAAGCGCTTTA
>probe:Drosophila_2:1639433_at:244:659; Interrogation_Position=1797; Antisense; TAAGCGCTTTATACGACTATTATGT
>probe:Drosophila_2:1639433_at:375:673; Interrogation_Position=1920; Antisense; TAGCGTTTATCATTAGGTCATTCAC
>probe:Drosophila_2:1639433_at:371:79; Interrogation_Position=1934; Antisense; AGGTCATTCACGTTTCTATATTAGT

Paste this into a BLAST search page for me
AGCAACAGCAAGTGAGCTCCACCAGGAGCCCTCGTCCAAGAAATTCCTAGAAATTCCTAGCTGGCGCCATCGAAAATCGAAAAGTCGAGCTCCGCTTGGAGAGGCCGTGGTAGATCAACCGCACACAGGCCACTTCTATGTTACGTTTATGATCACTTCAATGCTTTAGAACCCCTAGAACCCCATTAAGTTTCAACGATTATGTTTTTATGTATCCCCGTTTCGTTCGCTTTCTTCATTTTAAGTTCAGGTGTAGTTCTCGTTTAAGCGCTTTATAAGCGCTTTATACGACTATTATGTTAGCGTTTATCATTAGGTCATTCACAGGTCATTCACGTTTCTATATTAGT

Full Affymetrix probeset data:

Annotations for 1639433_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720