FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639434_at:

>probe:Drosophila_2:1639434_at:26:219; Interrogation_Position=352; Antisense; AAGTCTGTAGCCATTTGTCCGAATA
>probe:Drosophila_2:1639434_at:690:363; Interrogation_Position=372; Antisense; GAATAACCAACCTTTGTGCGGCAAT
>probe:Drosophila_2:1639434_at:259:549; Interrogation_Position=405; Antisense; GGAAGCCAGGAGTCTTCGTCAGGCC
>probe:Drosophila_2:1639434_at:504:449; Interrogation_Position=462; Antisense; GATCTGCAGGTATAGGAAACTCCGC
>probe:Drosophila_2:1639434_at:550:395; Interrogation_Position=487; Antisense; GAAATCATCCACCAAATGCGCGAAA
>probe:Drosophila_2:1639434_at:461:463; Interrogation_Position=513; Antisense; GATTCGCTGCATGGAAGGCAATCTT
>probe:Drosophila_2:1639434_at:222:367; Interrogation_Position=568; Antisense; GTAGCTTGGTCCAGCGAAGTTTCCA
>probe:Drosophila_2:1639434_at:363:505; Interrogation_Position=606; Antisense; GTGCCAGGAGCGATACAATTACCTT
>probe:Drosophila_2:1639434_at:75:233; Interrogation_Position=703; Antisense; AATGCAGCTTGCCTTTCCAAAAGTC
>probe:Drosophila_2:1639434_at:43:699; Interrogation_Position=750; Antisense; TTTCAATGGCGAGGTCAAGGATCTT
>probe:Drosophila_2:1639434_at:634:65; Interrogation_Position=817; Antisense; ATGGCTGTTTTCGAATCACGGCATT
>probe:Drosophila_2:1639434_at:548:649; Interrogation_Position=832; Antisense; TCACGGCATTCGAATTTTCTTGATG
>probe:Drosophila_2:1639434_at:550:373; Interrogation_Position=862; Antisense; GAAGAGTTTCTATCATCCTTGACTG
>probe:Drosophila_2:1639434_at:91:629; Interrogation_Position=877; Antisense; TCCTTGACTGTGACGGTTAGACTAT

Paste this into a BLAST search page for me
AAGTCTGTAGCCATTTGTCCGAATAGAATAACCAACCTTTGTGCGGCAATGGAAGCCAGGAGTCTTCGTCAGGCCGATCTGCAGGTATAGGAAACTCCGCGAAATCATCCACCAAATGCGCGAAAGATTCGCTGCATGGAAGGCAATCTTGTAGCTTGGTCCAGCGAAGTTTCCAGTGCCAGGAGCGATACAATTACCTTAATGCAGCTTGCCTTTCCAAAAGTCTTTCAATGGCGAGGTCAAGGATCTTATGGCTGTTTTCGAATCACGGCATTTCACGGCATTCGAATTTTCTTGATGGAAGAGTTTCTATCATCCTTGACTGTCCTTGACTGTGACGGTTAGACTAT

Full Affymetrix probeset data:

Annotations for 1639434_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720