Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639435_at:

>probe:Drosophila_2:1639435_at:728:143; Interrogation_Position=4389; Antisense; ACTGCGGCAACGTCCACTGGTGCAT
>probe:Drosophila_2:1639435_at:356:397; Interrogation_Position=4438; Antisense; GACAATCTTCTATTACGACTCAATG
>probe:Drosophila_2:1639435_at:531:591; Interrogation_Position=4461; Antisense; TGGGAAGACCAAACCAACCGGCGCT
>probe:Drosophila_2:1639435_at:531:129; Interrogation_Position=4477; Antisense; ACCGGCGCTTGATGCTCTAGTTAAA
>probe:Drosophila_2:1639435_at:393:145; Interrogation_Position=4519; Antisense; ACTAGACAAGCGCAAACAGCCGTTT
>probe:Drosophila_2:1639435_at:614:23; Interrogation_Position=4545; Antisense; ATATGACCGGTTTCGTTGTCGAGAA
>probe:Drosophila_2:1639435_at:704:381; Interrogation_Position=4567; Antisense; GAACGCGCAGAATATACCACGTCAA
>probe:Drosophila_2:1639435_at:524:241; Interrogation_Position=4595; Antisense; AATAGCAGCGATTGCGGTGTCTTCA
>probe:Drosophila_2:1639435_at:251:661; Interrogation_Position=4641; Antisense; TAACGCGTGATGTTCCGATTACCTT
>probe:Drosophila_2:1639435_at:34:13; Interrogation_Position=4658; Antisense; ATTACCTTCTCCCAGGCGGAAATGT
>probe:Drosophila_2:1639435_at:290:215; Interrogation_Position=4697; Antisense; AAGATGGCCCTGGAAATCGCCGACG
>probe:Drosophila_2:1639435_at:535:397; Interrogation_Position=4830; Antisense; GACAAGTACTTAGCCATCGAACGAA
>probe:Drosophila_2:1639435_at:524:367; Interrogation_Position=4870; Antisense; GAATCGAGATGGCTGAGACCCCTGC
>probe:Drosophila_2:1639435_at:521:103; Interrogation_Position=4885; Antisense; AGACCCCTGCTGGTGCATTAACTTG

Paste this into a BLAST search page for me
ACTGCGGCAACGTCCACTGGTGCATGACAATCTTCTATTACGACTCAATGTGGGAAGACCAAACCAACCGGCGCTACCGGCGCTTGATGCTCTAGTTAAAACTAGACAAGCGCAAACAGCCGTTTATATGACCGGTTTCGTTGTCGAGAAGAACGCGCAGAATATACCACGTCAAAATAGCAGCGATTGCGGTGTCTTCATAACGCGTGATGTTCCGATTACCTTATTACCTTCTCCCAGGCGGAAATGTAAGATGGCCCTGGAAATCGCCGACGGACAAGTACTTAGCCATCGAACGAAGAATCGAGATGGCTGAGACCCCTGCAGACCCCTGCTGGTGCATTAACTTG

Full Affymetrix probeset data:

Annotations for 1639435_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime