FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639436_at:

>probe:Drosophila_2:1639436_at:309:53; Interrogation_Position=1046; Antisense; ATGAGAGCGTTTCTCCCATAAGTTG
>probe:Drosophila_2:1639436_at:652:115; Interrogation_Position=473; Antisense; AGCATATTTACCTACTGCGCGGAAA
>probe:Drosophila_2:1639436_at:226:207; Interrogation_Position=547; Antisense; AAGCGGCGCTACACGGTGAAGCTGT
>probe:Drosophila_2:1639436_at:688:269; Interrogation_Position=568; Antisense; CTGTGGAAAACCTTTGTCGATTGCT
>probe:Drosophila_2:1639436_at:706:405; Interrogation_Position=650; Antisense; GACTGAGTCCGCAGCTGAAGGAGCT
>probe:Drosophila_2:1639436_at:701:553; Interrogation_Position=669; Antisense; GGAGCTGAGCAACATCGAATCGATT
>probe:Drosophila_2:1639436_at:91:391; Interrogation_Position=715; Antisense; GAAACGGGTCTGCTATGCGATCTGT
>probe:Drosophila_2:1639436_at:316:449; Interrogation_Position=754; Antisense; GATCGCTATGGATTCGGCTGGACAT
>probe:Drosophila_2:1639436_at:199:515; Interrogation_Position=791; Antisense; GTGTTAGCTATCTCTATGGTCGCGA
>probe:Drosophila_2:1639436_at:155:279; Interrogation_Position=804; Antisense; CTATGGTCGCGATGTCCTCGAGAAG
>probe:Drosophila_2:1639436_at:259:149; Interrogation_Position=845; Antisense; ACTTCGATCTGGTGTGTCGTGCCCA
>probe:Drosophila_2:1639436_at:85:177; Interrogation_Position=904; Antisense; AAACGCCAATTGGTCACCGTCTTCT
>probe:Drosophila_2:1639436_at:683:713; Interrogation_Position=925; Antisense; TTCTCGGCACCCAACTATTGTGGAT
>probe:Drosophila_2:1639436_at:63:251; Interrogation_Position=984; Antisense; CAAGGACCTAGTTATCTCTTTCGAT

Paste this into a BLAST search page for me
ATGAGAGCGTTTCTCCCATAAGTTGAGCATATTTACCTACTGCGCGGAAAAAGCGGCGCTACACGGTGAAGCTGTCTGTGGAAAACCTTTGTCGATTGCTGACTGAGTCCGCAGCTGAAGGAGCTGGAGCTGAGCAACATCGAATCGATTGAAACGGGTCTGCTATGCGATCTGTGATCGCTATGGATTCGGCTGGACATGTGTTAGCTATCTCTATGGTCGCGACTATGGTCGCGATGTCCTCGAGAAGACTTCGATCTGGTGTGTCGTGCCCAAAACGCCAATTGGTCACCGTCTTCTTTCTCGGCACCCAACTATTGTGGATCAAGGACCTAGTTATCTCTTTCGAT

Full Affymetrix probeset data:

Annotations for 1639436_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720