Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639439_at:

>probe:Drosophila_2:1639439_at:382:187; Interrogation_Position=1013; Antisense; AACACACCACAAACAAATCTCTCGT
>probe:Drosophila_2:1639439_at:449:321; Interrogation_Position=1064; Antisense; GCCCTCCTTCAACTTATTTATTCTG
>probe:Drosophila_2:1639439_at:48:53; Interrogation_Position=551; Antisense; ATGCGGTATATCATCTTATGCGAAA
>probe:Drosophila_2:1639439_at:97:455; Interrogation_Position=585; Antisense; GATCACCTGCAATCTCAGTGGCAAT
>probe:Drosophila_2:1639439_at:180:229; Interrogation_Position=607; Antisense; AATGTGCTCAAAAGCGTTTCGCCCA
>probe:Drosophila_2:1639439_at:426:255; Interrogation_Position=678; Antisense; CAACAAACTGTCGAGGCTGCCAGAA
>probe:Drosophila_2:1639439_at:591:313; Interrogation_Position=696; Antisense; GCCAGAAGAATTCGCCAGCTTGTCT
>probe:Drosophila_2:1639439_at:149:727; Interrogation_Position=715; Antisense; TTGTCTGCGCTAACCAAGCTGAATA
>probe:Drosophila_2:1639439_at:114:247; Interrogation_Position=748; Antisense; AATTCATTTATCGTTTTGCCACAAG
>probe:Drosophila_2:1639439_at:330:711; Interrogation_Position=779; Antisense; TTAAGCTTCAGAGTCTTGCCAGTCT
>probe:Drosophila_2:1639439_at:450:673; Interrogation_Position=852; Antisense; TACCAGTGACAATTTGGCCCTCGTT
>probe:Drosophila_2:1639439_at:663:575; Interrogation_Position=867; Antisense; GGCCCTCGTTGATCTTCGGAATAAT
>probe:Drosophila_2:1639439_at:32:29; Interrogation_Position=887; Antisense; ATAATCCGCTGAGCAGAAACTGCCG
>probe:Drosophila_2:1639439_at:199:231; Interrogation_Position=990; Antisense; AATGTCCTGTCCATTCATTTTCCAA

Paste this into a BLAST search page for me
AACACACCACAAACAAATCTCTCGTGCCCTCCTTCAACTTATTTATTCTGATGCGGTATATCATCTTATGCGAAAGATCACCTGCAATCTCAGTGGCAATAATGTGCTCAAAAGCGTTTCGCCCACAACAAACTGTCGAGGCTGCCAGAAGCCAGAAGAATTCGCCAGCTTGTCTTTGTCTGCGCTAACCAAGCTGAATAAATTCATTTATCGTTTTGCCACAAGTTAAGCTTCAGAGTCTTGCCAGTCTTACCAGTGACAATTTGGCCCTCGTTGGCCCTCGTTGATCTTCGGAATAATATAATCCGCTGAGCAGAAACTGCCGAATGTCCTGTCCATTCATTTTCCAA

Full Affymetrix probeset data:

Annotations for 1639439_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime