FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639440_at:

>probe:Drosophila_2:1639440_at:584:81; Interrogation_Position=130; Antisense; AGTGATTTGGCAACCGCCGAGACTT
>probe:Drosophila_2:1639440_at:420:661; Interrogation_Position=167; Antisense; TAAATCTCTTTGGAACTGGCTCTGG
>probe:Drosophila_2:1639440_at:153:197; Interrogation_Position=180; Antisense; AACTGGCTCTGGGTATCCGAACTAT
>probe:Drosophila_2:1639440_at:218:235; Interrogation_Position=20; Antisense; AATCCAGTGTCATGTTCATCAAGCT
>probe:Drosophila_2:1639440_at:198:67; Interrogation_Position=203; Antisense; ATGGCTACAACTATAATCGTCCGAG
>probe:Drosophila_2:1639440_at:4:385; Interrogation_Position=255; Antisense; GAACTACTACGGCTCATCGGGATAC
>probe:Drosophila_2:1639440_at:617:337; Interrogation_Position=287; Antisense; GCTCGGGATATGGATCTACCACCTA
>probe:Drosophila_2:1639440_at:162:341; Interrogation_Position=344; Antisense; GCTACTACCCAACTCAAGGCTATAA
>probe:Drosophila_2:1639440_at:541:677; Interrogation_Position=372; Antisense; TTATTCCACTAGCAGTTATCCGACC
>probe:Drosophila_2:1639440_at:208:693; Interrogation_Position=387; Antisense; TTATCCGACCACGAACATTCTGGGT
>probe:Drosophila_2:1639440_at:117:339; Interrogation_Position=42; Antisense; GCTATTTACCCTAATGTTGGCCGTG
>probe:Drosophila_2:1639440_at:550:241; Interrogation_Position=470; Antisense; AATACTCAGGCTATTGGCAGCGGGA
>probe:Drosophila_2:1639440_at:655:81; Interrogation_Position=567; Antisense; AGATCGTTCCTATGGTTCGAGTTCC
>probe:Drosophila_2:1639440_at:343:717; Interrogation_Position=582; Antisense; TTCGAGTTCCTATCGTGGCTATAAC

Paste this into a BLAST search page for me
AGTGATTTGGCAACCGCCGAGACTTTAAATCTCTTTGGAACTGGCTCTGGAACTGGCTCTGGGTATCCGAACTATAATCCAGTGTCATGTTCATCAAGCTATGGCTACAACTATAATCGTCCGAGGAACTACTACGGCTCATCGGGATACGCTCGGGATATGGATCTACCACCTAGCTACTACCCAACTCAAGGCTATAATTATTCCACTAGCAGTTATCCGACCTTATCCGACCACGAACATTCTGGGTGCTATTTACCCTAATGTTGGCCGTGAATACTCAGGCTATTGGCAGCGGGAAGATCGTTCCTATGGTTCGAGTTCCTTCGAGTTCCTATCGTGGCTATAAC

Full Affymetrix probeset data:

Annotations for 1639440_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720