FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639443_at:

>probe:Drosophila_2:1639443_at:549:35; Interrogation_Position=189; Antisense; ATCAGTGCAGCTGCGGTCGCGACCT
>probe:Drosophila_2:1639443_at:54:201; Interrogation_Position=239; Antisense; AACGCCTACGCCAATGCGAATGCAT
>probe:Drosophila_2:1639443_at:534:369; Interrogation_Position=256; Antisense; GAATGCATCTCTGGACCGCGAGGCG
>probe:Drosophila_2:1639443_at:273:595; Interrogation_Position=321; Antisense; TGACGGCCAAGGTGATGTTCGGTAC
>probe:Drosophila_2:1639443_at:46:601; Interrogation_Position=336; Antisense; TGTTCGGTACGGTGGGCGCCATCAA
>probe:Drosophila_2:1639443_at:116:613; Interrogation_Position=575; Antisense; TGACACAAAGAATTCGCGCCACTTC
>probe:Drosophila_2:1639443_at:386:633; Interrogation_Position=588; Antisense; TCGCGCCACTTCAAGGACCTAAAGA
>probe:Drosophila_2:1639443_at:727:9; Interrogation_Position=613; Antisense; ATTCAAGTTCGCGTAGTTCCCAAGA
>probe:Drosophila_2:1639443_at:352:627; Interrogation_Position=621; Antisense; TCGCGTAGTTCCCAAGATTCCAATG
>probe:Drosophila_2:1639443_at:523:159; Interrogation_Position=654; Antisense; AAATAGTTCGATTCGTATGACCCGA
>probe:Drosophila_2:1639443_at:64:681; Interrogation_Position=669; Antisense; TATGACCCGAATGGGTGATCCCCGG
>probe:Drosophila_2:1639443_at:649:445; Interrogation_Position=685; Antisense; GATCCCCGGATCACGTTAGAGGCTT
>probe:Drosophila_2:1639443_at:353:401; Interrogation_Position=726; Antisense; GACAGGGCAATCTGTGTAACGACAT
>probe:Drosophila_2:1639443_at:65:493; Interrogation_Position=741; Antisense; GTAACGACATTCCTTCTCAACAATA

Paste this into a BLAST search page for me
ATCAGTGCAGCTGCGGTCGCGACCTAACGCCTACGCCAATGCGAATGCATGAATGCATCTCTGGACCGCGAGGCGTGACGGCCAAGGTGATGTTCGGTACTGTTCGGTACGGTGGGCGCCATCAATGACACAAAGAATTCGCGCCACTTCTCGCGCCACTTCAAGGACCTAAAGAATTCAAGTTCGCGTAGTTCCCAAGATCGCGTAGTTCCCAAGATTCCAATGAAATAGTTCGATTCGTATGACCCGATATGACCCGAATGGGTGATCCCCGGGATCCCCGGATCACGTTAGAGGCTTGACAGGGCAATCTGTGTAACGACATGTAACGACATTCCTTCTCAACAATA

Full Affymetrix probeset data:

Annotations for 1639443_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720