FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639446_at:

>probe:Drosophila_2:1639446_at:656:521; Interrogation_Position=1056; Antisense; GTGGCGCCAAAACGAACAGCTTTCT
>probe:Drosophila_2:1639446_at:268:155; Interrogation_Position=1071; Antisense; ACAGCTTTCTCGCAAGTTCCGGGAG
>probe:Drosophila_2:1639446_at:500:111; Interrogation_Position=1138; Antisense; AGCAATTCACAGCTGGCCGATTTTA
>probe:Drosophila_2:1639446_at:187:63; Interrogation_Position=1172; Antisense; ATGTGCTCAATCTGTTGCGGTACAA
>probe:Drosophila_2:1639446_at:269:205; Interrogation_Position=1195; Antisense; AAGCCCAGCAATGTCCTAGAGTTCT
>probe:Drosophila_2:1639446_at:392:429; Interrogation_Position=1213; Antisense; GAGTTCTCCATTATGTTTTTCCAGA
>probe:Drosophila_2:1639446_at:158:691; Interrogation_Position=760; Antisense; TTTGTGGGCAACTTCGAGTACTACA
>probe:Drosophila_2:1639446_at:293:53; Interrogation_Position=787; Antisense; ATGAATTTGTATGGCCGGGTCCTTC
>probe:Drosophila_2:1639446_at:534:715; Interrogation_Position=809; Antisense; TTCGCTGCAATCTGGTTGTTTCCAA
>probe:Drosophila_2:1639446_at:307:211; Interrogation_Position=871; Antisense; AAGAATGTCGTGCACATCTTCACCC
>probe:Drosophila_2:1639446_at:305:645; Interrogation_Position=887; Antisense; TCTTCACCCAGCAATGTTTCAACGA
>probe:Drosophila_2:1639446_at:404:479; Interrogation_Position=902; Antisense; GTTTCAACGATGAGCTCCAGGATGT
>probe:Drosophila_2:1639446_at:459:607; Interrogation_Position=948; Antisense; TGAGGGCCGGATTGTTCTGCATTAT
>probe:Drosophila_2:1639446_at:17:329; Interrogation_Position=975; Antisense; GCGTGGCTATAACTACCTTTTGCAT

Paste this into a BLAST search page for me
GTGGCGCCAAAACGAACAGCTTTCTACAGCTTTCTCGCAAGTTCCGGGAGAGCAATTCACAGCTGGCCGATTTTAATGTGCTCAATCTGTTGCGGTACAAAAGCCCAGCAATGTCCTAGAGTTCTGAGTTCTCCATTATGTTTTTCCAGATTTGTGGGCAACTTCGAGTACTACAATGAATTTGTATGGCCGGGTCCTTCTTCGCTGCAATCTGGTTGTTTCCAAAAGAATGTCGTGCACATCTTCACCCTCTTCACCCAGCAATGTTTCAACGAGTTTCAACGATGAGCTCCAGGATGTTGAGGGCCGGATTGTTCTGCATTATGCGTGGCTATAACTACCTTTTGCAT

Full Affymetrix probeset data:

Annotations for 1639446_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720