FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639449_at:

>probe:Drosophila_2:1639449_at:577:233; Interrogation_Position=190; Antisense; AATGCGTGGGCCCTGGGCCATAAAA
>probe:Drosophila_2:1639449_at:658:575; Interrogation_Position=198; Antisense; GGCCCTGGGCCATAAAAGTAATACT
>probe:Drosophila_2:1639449_at:15:319; Interrogation_Position=199; Antisense; GCCCTGGGCCATAAAAGTAATACTA
>probe:Drosophila_2:1639449_at:344:493; Interrogation_Position=215; Antisense; GTAATACTAAAAACGTGTCTCAGGC
>probe:Drosophila_2:1639449_at:398:1; Interrogation_Position=218; Antisense; ATACTAAAAACGTGTCTCAGGCCCA
>probe:Drosophila_2:1639449_at:192:147; Interrogation_Position=220; Antisense; ACTAAAAACGTGTCTCAGGCCCACA
>probe:Drosophila_2:1639449_at:325:661; Interrogation_Position=222; Antisense; TAAAAACGTGTCTCAGGCCCACATG
>probe:Drosophila_2:1639449_at:127:179; Interrogation_Position=223; Antisense; AAAAACGTGTCTCAGGCCCACATGG
>probe:Drosophila_2:1639449_at:537:175; Interrogation_Position=225; Antisense; AAACGTGTCTCAGGCCCACATGGCA
>probe:Drosophila_2:1639449_at:565:515; Interrogation_Position=229; Antisense; GTGTCTCAGGCCCACATGGCAGACA
>probe:Drosophila_2:1639449_at:303:499; Interrogation_Position=231; Antisense; GTCTCAGGCCCACATGGCAGACATT
>probe:Drosophila_2:1639449_at:191:649; Interrogation_Position=234; Antisense; TCAGGCCCACATGGCAGACATTCTA
>probe:Drosophila_2:1639449_at:566:577; Interrogation_Position=237; Antisense; GGCCCACATGGCAGACATTCTACAG
>probe:Drosophila_2:1639449_at:162:311; Interrogation_Position=240; Antisense; CCACATGGCAGACATTCTACAGCAG

Paste this into a BLAST search page for me
AATGCGTGGGCCCTGGGCCATAAAAGGCCCTGGGCCATAAAAGTAATACTGCCCTGGGCCATAAAAGTAATACTAGTAATACTAAAAACGTGTCTCAGGCATACTAAAAACGTGTCTCAGGCCCAACTAAAAACGTGTCTCAGGCCCACATAAAAACGTGTCTCAGGCCCACATGAAAAACGTGTCTCAGGCCCACATGGAAACGTGTCTCAGGCCCACATGGCAGTGTCTCAGGCCCACATGGCAGACAGTCTCAGGCCCACATGGCAGACATTTCAGGCCCACATGGCAGACATTCTAGGCCCACATGGCAGACATTCTACAGCCACATGGCAGACATTCTACAGCAG

Full Affymetrix probeset data:

Annotations for 1639449_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720