Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639452_at:

>probe:Drosophila_2:1639452_at:119:173; Interrogation_Position=121; Antisense; AAAGAGCCTGAGTCTCGAGTCTGGA
>probe:Drosophila_2:1639452_at:262:591; Interrogation_Position=203; Antisense; TGGTCAAGAAGACATCCGCCAGCCT
>probe:Drosophila_2:1639452_at:239:301; Interrogation_Position=219; Antisense; CGCCAGCCTGGGAAAGAGCATCTTG
>probe:Drosophila_2:1639452_at:469:429; Interrogation_Position=248; Antisense; GAGTTCTGTTGTTTCTCGCCGTACA
>probe:Drosophila_2:1639452_at:3:389; Interrogation_Position=30; Antisense; GAAAAGTTCGCCGACAGCTTCATTA
>probe:Drosophila_2:1639452_at:632:553; Interrogation_Position=303; Antisense; GGAGCTGGAGCCTCGCAAAGGTCAT
>probe:Drosophila_2:1639452_at:53:359; Interrogation_Position=317; Antisense; GCAAAGGTCATGTGCCCGTCTACAT
>probe:Drosophila_2:1639452_at:204:583; Interrogation_Position=348; Antisense; TGGCGATGAGCCACTCAGCGAAATC
>probe:Drosophila_2:1639452_at:229:123; Interrogation_Position=364; Antisense; AGCGAAATCCATCCAGGACTGGCCG
>probe:Drosophila_2:1639452_at:516:367; Interrogation_Position=406; Antisense; GAATCGAAGAGTCTCGTCACCGAAT
>probe:Drosophila_2:1639452_at:570:629; Interrogation_Position=490; Antisense; TCCAGCTCCACGGTATCGGATATAG
>probe:Drosophila_2:1639452_at:654:543; Interrogation_Position=507; Antisense; GGATATAGCCAGCTTTGAGGCCATC
>probe:Drosophila_2:1639452_at:299:127; Interrogation_Position=57; Antisense; AGCCATCATCGGAGCCATCATCATT
>probe:Drosophila_2:1639452_at:274:647; Interrogation_Position=74; Antisense; TCATCATTCGCGTGCACTGCGAGAA

Paste this into a BLAST search page for me
AAAGAGCCTGAGTCTCGAGTCTGGATGGTCAAGAAGACATCCGCCAGCCTCGCCAGCCTGGGAAAGAGCATCTTGGAGTTCTGTTGTTTCTCGCCGTACAGAAAAGTTCGCCGACAGCTTCATTAGGAGCTGGAGCCTCGCAAAGGTCATGCAAAGGTCATGTGCCCGTCTACATTGGCGATGAGCCACTCAGCGAAATCAGCGAAATCCATCCAGGACTGGCCGGAATCGAAGAGTCTCGTCACCGAATTCCAGCTCCACGGTATCGGATATAGGGATATAGCCAGCTTTGAGGCCATCAGCCATCATCGGAGCCATCATCATTTCATCATTCGCGTGCACTGCGAGAA

Full Affymetrix probeset data:

Annotations for 1639452_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime