FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639453_at:

>probe:Drosophila_2:1639453_at:257:413; Interrogation_Position=2165; Antisense; GACCAGGACAAGATCCAGGTGCTGC
>probe:Drosophila_2:1639453_at:591:267; Interrogation_Position=2180; Antisense; CAGGTGCTGCTGGAGGAAACGCTTA
>probe:Drosophila_2:1639453_at:9:121; Interrogation_Position=2289; Antisense; AGCTGGAGCGCAACTGGTCGATATC
>probe:Drosophila_2:1639453_at:20:537; Interrogation_Position=2304; Antisense; GGTCGATATCCTCGGATGCAGACAA
>probe:Drosophila_2:1639453_at:296:567; Interrogation_Position=2333; Antisense; GGCACTGCCGTGATGTATGTACCGC
>probe:Drosophila_2:1639453_at:62:407; Interrogation_Position=2381; Antisense; GACGTCGACGTAGAACACTCGGGCA
>probe:Drosophila_2:1639453_at:7:387; Interrogation_Position=2393; Antisense; GAACACTCGGGCACGACGAGCAATT
>probe:Drosophila_2:1639453_at:443:341; Interrogation_Position=2428; Antisense; GCTTAGTATTCAGGGCATGCCGGCG
>probe:Drosophila_2:1639453_at:691:625; Interrogation_Position=2445; Antisense; TGCCGGCGCGTATTGTTTTTATTAT
>probe:Drosophila_2:1639453_at:478:601; Interrogation_Position=2598; Antisense; TGTTGAACCAGGCTTCCAGGCTAAA
>probe:Drosophila_2:1639453_at:479:215; Interrogation_Position=2621; Antisense; AAGATTTCGATGACGTGGGACACGC
>probe:Drosophila_2:1639453_at:10:567; Interrogation_Position=2646; Antisense; GGCAGACAAAGGTGGGTCGCCTCTC
>probe:Drosophila_2:1639453_at:215:317; Interrogation_Position=2664; Antisense; GCCTCTCGCGAGCACGATGAACATT
>probe:Drosophila_2:1639453_at:412:349; Interrogation_Position=2696; Antisense; GCAGGAACACTTAGCGACATGTCTT

Paste this into a BLAST search page for me
GACCAGGACAAGATCCAGGTGCTGCCAGGTGCTGCTGGAGGAAACGCTTAAGCTGGAGCGCAACTGGTCGATATCGGTCGATATCCTCGGATGCAGACAAGGCACTGCCGTGATGTATGTACCGCGACGTCGACGTAGAACACTCGGGCAGAACACTCGGGCACGACGAGCAATTGCTTAGTATTCAGGGCATGCCGGCGTGCCGGCGCGTATTGTTTTTATTATTGTTGAACCAGGCTTCCAGGCTAAAAAGATTTCGATGACGTGGGACACGCGGCAGACAAAGGTGGGTCGCCTCTCGCCTCTCGCGAGCACGATGAACATTGCAGGAACACTTAGCGACATGTCTT

Full Affymetrix probeset data:

Annotations for 1639453_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720