FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639454_at:

>probe:Drosophila_2:1639454_at:642:269; Interrogation_Position=354; Antisense; CATGTTCCTGCTGGACTGCGATAAA
>probe:Drosophila_2:1639454_at:238:325; Interrogation_Position=389; Antisense; GCGAAAATGCTCTATCCTGCTACTC
>probe:Drosophila_2:1639454_at:101:621; Interrogation_Position=406; Antisense; TGCTACTCCACTGAGGGTCCGACAT
>probe:Drosophila_2:1639454_at:361:531; Interrogation_Position=420; Antisense; GGGTCCGACATATTCCAAGCAGTTG
>probe:Drosophila_2:1639454_at:401:209; Interrogation_Position=436; Antisense; AAGCAGTTGTCGAATGTGGCAGCCA
>probe:Drosophila_2:1639454_at:418:231; Interrogation_Position=460; Antisense; AATGCTTCGGTCTCGGTCAGTTCAC
>probe:Drosophila_2:1639454_at:608:389; Interrogation_Position=499; Antisense; GAAACACTGGTGTTCACCCGTGACC
>probe:Drosophila_2:1639454_at:503:233; Interrogation_Position=524; Antisense; AATGCTGTTCTGCAACGTCCAGGAA
>probe:Drosophila_2:1639454_at:620:561; Interrogation_Position=545; Antisense; GGAACTATGAGATCCGCTCCGGCGA
>probe:Drosophila_2:1639454_at:618:287; Interrogation_Position=564; Antisense; CGGCGAGTCCTACGAAGATCTTCAG
>probe:Drosophila_2:1639454_at:452:317; Interrogation_Position=593; Antisense; GCCTGAGCGGTGAGAATCCTGTGCC
>probe:Drosophila_2:1639454_at:488:427; Interrogation_Position=750; Antisense; GAGATCTCCATCGACAGTTGCGCAT
>probe:Drosophila_2:1639454_at:120:95; Interrogation_Position=765; Antisense; AGTTGCGCATTTTAGTTCCGTTGAA
>probe:Drosophila_2:1639454_at:365:127; Interrogation_Position=805; Antisense; AGCCAGCACCGATTTCCAAGAAGAC

Paste this into a BLAST search page for me
CATGTTCCTGCTGGACTGCGATAAAGCGAAAATGCTCTATCCTGCTACTCTGCTACTCCACTGAGGGTCCGACATGGGTCCGACATATTCCAAGCAGTTGAAGCAGTTGTCGAATGTGGCAGCCAAATGCTTCGGTCTCGGTCAGTTCACGAAACACTGGTGTTCACCCGTGACCAATGCTGTTCTGCAACGTCCAGGAAGGAACTATGAGATCCGCTCCGGCGACGGCGAGTCCTACGAAGATCTTCAGGCCTGAGCGGTGAGAATCCTGTGCCGAGATCTCCATCGACAGTTGCGCATAGTTGCGCATTTTAGTTCCGTTGAAAGCCAGCACCGATTTCCAAGAAGAC

Full Affymetrix probeset data:

Annotations for 1639454_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720