FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639456_at:

>probe:Drosophila_2:1639456_at:448:55; Interrogation_Position=107; Antisense; ATGTCGTCACTTCTCGCTTAAAGGA
>probe:Drosophila_2:1639456_at:126:555; Interrogation_Position=129; Antisense; GGAGCGCCTCAAAGAAGCTGATTCT
>probe:Drosophila_2:1639456_at:406:119; Interrogation_Position=144; Antisense; AGCTGATTCTGATTTTTCTGGCCAA
>probe:Drosophila_2:1639456_at:5:35; Interrogation_Position=194; Antisense; ATCTTCCGCTTTTTCAACTGGACGA
>probe:Drosophila_2:1639456_at:545:609; Interrogation_Position=237; Antisense; TGAGCTCAATCTTATCCAGCGGACT
>probe:Drosophila_2:1639456_at:444:147; Interrogation_Position=263; Antisense; ACATCTCCTCGGTTTCAACTAGCGA
>probe:Drosophila_2:1639456_at:244:193; Interrogation_Position=279; Antisense; AACTAGCGAGCCAGTGATCCGGAAT
>probe:Drosophila_2:1639456_at:370:485; Interrogation_Position=341; Antisense; GTATGACATACACCCAGTTCGAAAG
>probe:Drosophila_2:1639456_at:99:17; Interrogation_Position=37; Antisense; ATTTTGGTATTATCCCAGGGCATCC
>probe:Drosophila_2:1639456_at:156:405; Interrogation_Position=377; Antisense; GACTCCTTAGGAGGCTTGGCATTTA
>probe:Drosophila_2:1639456_at:546:25; Interrogation_Position=404; Antisense; ATAGCTTCACTGTTCGCGTATTCAA
>probe:Drosophila_2:1639456_at:372:327; Interrogation_Position=419; Antisense; GCGTATTCAAGGCAATCTTCAGCGA
>probe:Drosophila_2:1639456_at:434:393; Interrogation_Position=520; Antisense; GACAAGGACTTATTGTGGGCCCATA
>probe:Drosophila_2:1639456_at:161:517; Interrogation_Position=534; Antisense; GTGGGCCCATATCATCGATTTGTTT

Paste this into a BLAST search page for me
ATGTCGTCACTTCTCGCTTAAAGGAGGAGCGCCTCAAAGAAGCTGATTCTAGCTGATTCTGATTTTTCTGGCCAAATCTTCCGCTTTTTCAACTGGACGATGAGCTCAATCTTATCCAGCGGACTACATCTCCTCGGTTTCAACTAGCGAAACTAGCGAGCCAGTGATCCGGAATGTATGACATACACCCAGTTCGAAAGATTTTGGTATTATCCCAGGGCATCCGACTCCTTAGGAGGCTTGGCATTTAATAGCTTCACTGTTCGCGTATTCAAGCGTATTCAAGGCAATCTTCAGCGAGACAAGGACTTATTGTGGGCCCATAGTGGGCCCATATCATCGATTTGTTT

Full Affymetrix probeset data:

Annotations for 1639456_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720