FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639457_at:

>probe:Drosophila_2:1639457_at:306:557; Interrogation_Position=118; Antisense; GGAAGAAGCCTGCAGCGAAGTTACA
>probe:Drosophila_2:1639457_at:518:295; Interrogation_Position=133; Antisense; CGAAGTTACAACCACCACCATAATG
>probe:Drosophila_2:1639457_at:255:203; Interrogation_Position=161; Antisense; AACCAGGCTGATCCAACTTGTAGAA
>probe:Drosophila_2:1639457_at:502:473; Interrogation_Position=198; Antisense; GTTACGTGGTCAATGGATCAGTTTT
>probe:Drosophila_2:1639457_at:272:511; Interrogation_Position=245; Antisense; GTGAACCAGTACTTTGATCCCAATT
>probe:Drosophila_2:1639457_at:434:183; Interrogation_Position=272; Antisense; AAAATGTGCCGGTCTGAAGTTCCAG
>probe:Drosophila_2:1639457_at:201:99; Interrogation_Position=295; Antisense; AGATGAATGTTCTGCAATGGCACCA
>probe:Drosophila_2:1639457_at:212:191; Interrogation_Position=323; Antisense; AACTAAATCCCACGGCATCTTTCAT
>probe:Drosophila_2:1639457_at:508:271; Interrogation_Position=338; Antisense; CATCTTTCATGCCACTTTGAACTTC
>probe:Drosophila_2:1639457_at:610:59; Interrogation_Position=35; Antisense; ATGTTTTTACTGTTGCTGGCTCATT
>probe:Drosophila_2:1639457_at:564:693; Interrogation_Position=353; Antisense; TTTGAACTTCTGCAGCGCCAATAAG
>probe:Drosophila_2:1639457_at:73:681; Interrogation_Position=387; Antisense; TATCTGAATTTCTTGGAACCCAAAG
>probe:Drosophila_2:1639457_at:261:693; Interrogation_Position=70; Antisense; TTTGCCAGCTCCAGAGTTTGACGAC
>probe:Drosophila_2:1639457_at:125:479; Interrogation_Position=85; Antisense; GTTTGACGACCACAACTCGAAGACT

Paste this into a BLAST search page for me
GGAAGAAGCCTGCAGCGAAGTTACACGAAGTTACAACCACCACCATAATGAACCAGGCTGATCCAACTTGTAGAAGTTACGTGGTCAATGGATCAGTTTTGTGAACCAGTACTTTGATCCCAATTAAAATGTGCCGGTCTGAAGTTCCAGAGATGAATGTTCTGCAATGGCACCAAACTAAATCCCACGGCATCTTTCATCATCTTTCATGCCACTTTGAACTTCATGTTTTTACTGTTGCTGGCTCATTTTTGAACTTCTGCAGCGCCAATAAGTATCTGAATTTCTTGGAACCCAAAGTTTGCCAGCTCCAGAGTTTGACGACGTTTGACGACCACAACTCGAAGACT

Full Affymetrix probeset data:

Annotations for 1639457_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720