Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639460_a_at:

>probe:Drosophila_2:1639460_a_at:432:191; Interrogation_Position=465; Antisense; AACTCGGCGGGCATCCATAGGCTAG
>probe:Drosophila_2:1639460_a_at:473:143; Interrogation_Position=491; Antisense; ACTGATGGGCGTCCTAACTGGCACA
>probe:Drosophila_2:1639460_a_at:582:143; Interrogation_Position=515; Antisense; ACTGCTCTCGGTGATTGTGGCTCAT
>probe:Drosophila_2:1639460_a_at:321:729; Interrogation_Position=529; Antisense; TTGTGGCTCATCTTCTGCGGCAATA
>probe:Drosophila_2:1639460_a_at:518:519; Interrogation_Position=555; Antisense; GTGGATCCACCTGCTTCAGCTGTAG
>probe:Drosophila_2:1639460_a_at:536:115; Interrogation_Position=633; Antisense; AGCATGCTTGCTTGTGTGTTCAACG
>probe:Drosophila_2:1639460_a_at:385:115; Interrogation_Position=739; Antisense; AGCAGTAACTTACCTGACGCGCGAA
>probe:Drosophila_2:1639460_a_at:299:135; Interrogation_Position=755; Antisense; ACGCGCGAACAGTCTTGTGGTGAAT
>probe:Drosophila_2:1639460_a_at:367:327; Interrogation_Position=782; Antisense; GCGATGTGTAATCAAGTGCCTTTTC
>probe:Drosophila_2:1639460_a_at:557:499; Interrogation_Position=797; Antisense; GTGCCTTTTCTGTAACGGACTCGTA
>probe:Drosophila_2:1639460_a_at:81:547; Interrogation_Position=813; Antisense; GGACTCGTATTGTAACTTAAGCCTG
>probe:Drosophila_2:1639460_a_at:49:127; Interrogation_Position=832; Antisense; AGCCTGGAATACTATTTCCGTCCAA
>probe:Drosophila_2:1639460_a_at:137:315; Interrogation_Position=869; Antisense; GCCTATGACATTCCATCTCGTAAAC
>probe:Drosophila_2:1639460_a_at:587:447; Interrogation_Position=949; Antisense; GATCGCCTAGTTTTAGTCGACTTAC

Paste this into a BLAST search page for me
AACTCGGCGGGCATCCATAGGCTAGACTGATGGGCGTCCTAACTGGCACAACTGCTCTCGGTGATTGTGGCTCATTTGTGGCTCATCTTCTGCGGCAATAGTGGATCCACCTGCTTCAGCTGTAGAGCATGCTTGCTTGTGTGTTCAACGAGCAGTAACTTACCTGACGCGCGAAACGCGCGAACAGTCTTGTGGTGAATGCGATGTGTAATCAAGTGCCTTTTCGTGCCTTTTCTGTAACGGACTCGTAGGACTCGTATTGTAACTTAAGCCTGAGCCTGGAATACTATTTCCGTCCAAGCCTATGACATTCCATCTCGTAAACGATCGCCTAGTTTTAGTCGACTTAC

Full Affymetrix probeset data:

Annotations for 1639460_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime