Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639463_x_at:

>probe:Drosophila_2:1639463_x_at:573:501; Interrogation_Position=107; Antisense; GTCGTAAATGGGACTCTGTTTTCGA
>probe:Drosophila_2:1639463_x_at:162:41; Interrogation_Position=13; Antisense; ATCGATCCAGAACGTACCATGGGTA
>probe:Drosophila_2:1639463_x_at:664:419; Interrogation_Position=130; Antisense; GAGCAGTTGTGCCAGATAAACATAA
>probe:Drosophila_2:1639463_x_at:666:505; Interrogation_Position=138; Antisense; GTGCCAGATAAACATAAAACATTTT
>probe:Drosophila_2:1639463_x_at:206:447; Interrogation_Position=16; Antisense; GATCCAGAACGTACCATGGGTAACG
>probe:Drosophila_2:1639463_x_at:413:457; Interrogation_Position=168; Antisense; GATAGTTTTTCCAAAGAAATGTGTG
>probe:Drosophila_2:1639463_x_at:286:393; Interrogation_Position=183; Antisense; GAAATGTGTGAATCATTGTTTCAAA
>probe:Drosophila_2:1639463_x_at:158:239; Interrogation_Position=193; Antisense; AATCATTGTTTCAAAATGCGATACA
>probe:Drosophila_2:1639463_x_at:57:487; Interrogation_Position=26; Antisense; GTACCATGGGTAACGATATACGAAG
>probe:Drosophila_2:1639463_x_at:564:659; Interrogation_Position=36; Antisense; TAACGATATACGAAGCGATGCTTGG
>probe:Drosophila_2:1639463_x_at:434:727; Interrogation_Position=64; Antisense; TTGGGCATCACTTTGATGGAGGTAG
>probe:Drosophila_2:1639463_x_at:66:35; Interrogation_Position=70; Antisense; ATCACTTTGATGGAGGTAGCGACTG
>probe:Drosophila_2:1639463_x_at:622:277; Interrogation_Position=74; Antisense; CTTTGATGGAGGTAGCGACTGGTAA
>probe:Drosophila_2:1639463_x_at:413:325; Interrogation_Position=88; Antisense; GCGACTGGTAATTTCCCTTGTCGTA

Paste this into a BLAST search page for me
GTCGTAAATGGGACTCTGTTTTCGAATCGATCCAGAACGTACCATGGGTAGAGCAGTTGTGCCAGATAAACATAAGTGCCAGATAAACATAAAACATTTTGATCCAGAACGTACCATGGGTAACGGATAGTTTTTCCAAAGAAATGTGTGGAAATGTGTGAATCATTGTTTCAAAAATCATTGTTTCAAAATGCGATACAGTACCATGGGTAACGATATACGAAGTAACGATATACGAAGCGATGCTTGGTTGGGCATCACTTTGATGGAGGTAGATCACTTTGATGGAGGTAGCGACTGCTTTGATGGAGGTAGCGACTGGTAAGCGACTGGTAATTTCCCTTGTCGTA

Full Affymetrix probeset data:

Annotations for 1639463_x_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime