Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639466_s_at:

>probe:Drosophila_2:1639466_s_at:268:211; Interrogation_Position=148; Antisense; AAGAAGAAGAGGAGCCAGAGCAGAA
>probe:Drosophila_2:1639466_s_at:149:347; Interrogation_Position=15; Antisense; GCATCCACGCAGCAACGTTGAGCTG
>probe:Drosophila_2:1639466_s_at:284:49; Interrogation_Position=17; Antisense; ATCCACGCAGCAACGTTGAGCTGGA
>probe:Drosophila_2:1639466_s_at:499:547; Interrogation_Position=189; Antisense; GGAGTAGCAGTCAGAGGACAAACTA
>probe:Drosophila_2:1639466_s_at:485:135; Interrogation_Position=21; Antisense; ACGCAGCAACGTTGAGCTGGACGTT
>probe:Drosophila_2:1639466_s_at:698:109; Interrogation_Position=25; Antisense; AGCAACGTTGAGCTGGACGTTGAAC
>probe:Drosophila_2:1639466_s_at:232:409; Interrogation_Position=40; Antisense; GACGTTGAACGGGTGACACGAGCGG
>probe:Drosophila_2:1639466_s_at:413:397; Interrogation_Position=54; Antisense; GACACGAGCGGGAGGAAATGTAGCC
>probe:Drosophila_2:1639466_s_at:95:167; Interrogation_Position=69; Antisense; AAATGTAGCCGATGAGAGGCCTAAA
>probe:Drosophila_2:1639466_s_at:261:423; Interrogation_Position=82; Antisense; GAGAGGCCTAAAGAATTCGCTGAGT
>probe:Drosophila_2:1639466_s_at:403:437; Interrogation_Position=84; Antisense; GAGGCCTAAAGAATTCGCTGAGTTC
>probe:Drosophila_2:1639466_s_at:488:109; Interrogation_Position=93; Antisense; AGAATTCGCTGAGTTCTTTGGCCAG
>probe:Drosophila_2:1639466_s_at:14:247; Interrogation_Position=95; Antisense; AATTCGCTGAGTTCTTTGGCCAGGA
>probe:Drosophila_2:1639466_s_at:248:7; Interrogation_Position=96; Antisense; ATTCGCTGAGTTCTTTGGCCAGGAG

Paste this into a BLAST search page for me
AAGAAGAAGAGGAGCCAGAGCAGAAGCATCCACGCAGCAACGTTGAGCTGATCCACGCAGCAACGTTGAGCTGGAGGAGTAGCAGTCAGAGGACAAACTAACGCAGCAACGTTGAGCTGGACGTTAGCAACGTTGAGCTGGACGTTGAACGACGTTGAACGGGTGACACGAGCGGGACACGAGCGGGAGGAAATGTAGCCAAATGTAGCCGATGAGAGGCCTAAAGAGAGGCCTAAAGAATTCGCTGAGTGAGGCCTAAAGAATTCGCTGAGTTCAGAATTCGCTGAGTTCTTTGGCCAGAATTCGCTGAGTTCTTTGGCCAGGAATTCGCTGAGTTCTTTGGCCAGGAG

Full Affymetrix probeset data:

Annotations for 1639466_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime