FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639467_at:

>probe:Drosophila_2:1639467_at:478:281; Interrogation_Position=1003; Antisense; TCACACCCTTTCTGGGCCATTTAAT
>probe:Drosophila_2:1639467_at:696:305; Interrogation_Position=1030; Antisense; CCATTGCTGTAATTGATCCGTGCGA
>probe:Drosophila_2:1639467_at:187:305; Interrogation_Position=1047; Antisense; CCGTGCGAATGCTTTGTACTTTACT
>probe:Drosophila_2:1639467_at:69:481; Interrogation_Position=1154; Antisense; GTATGGTTACGAATAGGACTCTCTC
>probe:Drosophila_2:1639467_at:727:401; Interrogation_Position=1170; Antisense; GACTCTCTCGGTTAAGTGTACGGTA
>probe:Drosophila_2:1639467_at:232:659; Interrogation_Position=637; Antisense; TAACTAACTTTGCTCCGGTCGGGAT
>probe:Drosophila_2:1639467_at:171:361; Interrogation_Position=731; Antisense; GCAAGCTTACAATATGGACGGCGAG
>probe:Drosophila_2:1639467_at:283:557; Interrogation_Position=746; Antisense; GGACGGCGAGTTAGCTAAACGAATT
>probe:Drosophila_2:1639467_at:334:389; Interrogation_Position=774; Antisense; GAAAACCGCAGGAAATGCCACATGA
>probe:Drosophila_2:1639467_at:132:397; Interrogation_Position=808; Antisense; GAAATTGATCTGATACGCAGGGCAA
>probe:Drosophila_2:1639467_at:163:23; Interrogation_Position=896; Antisense; ATATACATTTTCCAAACGCGTTAGT
>probe:Drosophila_2:1639467_at:528:13; Interrogation_Position=927; Antisense; ATTAAACTCTGCTTTGTGTCCTACC
>probe:Drosophila_2:1639467_at:587:715; Interrogation_Position=940; Antisense; TTGTGTCCTACCCATTAACGAAACA
>probe:Drosophila_2:1639467_at:648:181; Interrogation_Position=990; Antisense; AAAACAGATCTATTCACACCCTTTC

Paste this into a BLAST search page for me
TCACACCCTTTCTGGGCCATTTAATCCATTGCTGTAATTGATCCGTGCGACCGTGCGAATGCTTTGTACTTTACTGTATGGTTACGAATAGGACTCTCTCGACTCTCTCGGTTAAGTGTACGGTATAACTAACTTTGCTCCGGTCGGGATGCAAGCTTACAATATGGACGGCGAGGGACGGCGAGTTAGCTAAACGAATTGAAAACCGCAGGAAATGCCACATGAGAAATTGATCTGATACGCAGGGCAAATATACATTTTCCAAACGCGTTAGTATTAAACTCTGCTTTGTGTCCTACCTTGTGTCCTACCCATTAACGAAACAAAAACAGATCTATTCACACCCTTTC

Full Affymetrix probeset data:

Annotations for 1639467_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720