Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639474_at:

>probe:Drosophila_2:1639474_at:686:333; Interrogation_Position=126; Antisense; GCTGTCCTGGCCATCGCAATGGCAT
>probe:Drosophila_2:1639474_at:75:359; Interrogation_Position=141; Antisense; GCAATGGCATCTACCGCAACTACAA
>probe:Drosophila_2:1639474_at:671:405; Interrogation_Position=197; Antisense; GACGACGACGTACACCTATACTACC
>probe:Drosophila_2:1639474_at:143:101; Interrogation_Position=20; Antisense; AGAGTTCAGCAGCTCGTCCGTCGAT
>probe:Drosophila_2:1639474_at:566:203; Interrogation_Position=270; Antisense; AAGCCAATCAAGCAACAGCTCCTGT
>probe:Drosophila_2:1639474_at:293:187; Interrogation_Position=283; Antisense; AACAGCTCCTGTCCCTGCTGTTCAA
>probe:Drosophila_2:1639474_at:42:285; Interrogation_Position=297; Antisense; CTGCTGTTCAACAAGAAGTCCGGAT
>probe:Drosophila_2:1639474_at:221:211; Interrogation_Position=309; Antisense; AAGAAGTCCGGATAGAGCCGCCCAT
>probe:Drosophila_2:1639474_at:376:639; Interrogation_Position=33; Antisense; TCGTCCGTCGATAAGCAACAGCCAG
>probe:Drosophila_2:1639474_at:649:309; Interrogation_Position=339; Antisense; CCACGATGCTGCCACTTGATACGAT
>probe:Drosophila_2:1639474_at:90:701; Interrogation_Position=354; Antisense; TTGATACGATCCTCATCACCTGAAT
>probe:Drosophila_2:1639474_at:318:449; Interrogation_Position=361; Antisense; GATCCTCATCACCTGAATAGCCAAA
>probe:Drosophila_2:1639474_at:234:187; Interrogation_Position=49; Antisense; AACAGCCAGCCAGCAATCCTAAAAG
>probe:Drosophila_2:1639474_at:719:189; Interrogation_Position=90; Antisense; AACATGAAGTTCTTCGCTGTCCTCG

Paste this into a BLAST search page for me
GCTGTCCTGGCCATCGCAATGGCATGCAATGGCATCTACCGCAACTACAAGACGACGACGTACACCTATACTACCAGAGTTCAGCAGCTCGTCCGTCGATAAGCCAATCAAGCAACAGCTCCTGTAACAGCTCCTGTCCCTGCTGTTCAACTGCTGTTCAACAAGAAGTCCGGATAAGAAGTCCGGATAGAGCCGCCCATTCGTCCGTCGATAAGCAACAGCCAGCCACGATGCTGCCACTTGATACGATTTGATACGATCCTCATCACCTGAATGATCCTCATCACCTGAATAGCCAAAAACAGCCAGCCAGCAATCCTAAAAGAACATGAAGTTCTTCGCTGTCCTCG

Full Affymetrix probeset data:

Annotations for 1639474_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime