FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639476_at:

>probe:Drosophila_2:1639476_at:441:497; Interrogation_Position=135; Antisense; GTCATTGATCATCGGTGGCAGCCAA
>probe:Drosophila_2:1639476_at:630:567; Interrogation_Position=151; Antisense; GGCAGCCAAGCGATTCCTTATCGAC
>probe:Drosophila_2:1639476_at:445:133; Interrogation_Position=174; Antisense; ACCCTCGGCGTATCTGTACAATCAG
>probe:Drosophila_2:1639476_at:279:483; Interrogation_Position=206; Antisense; GTATGGATACATTGACGGGTCGGCA
>probe:Drosophila_2:1639476_at:115:531; Interrogation_Position=222; Antisense; GGGTCGGCAGCTTTATATCGGTGAA
>probe:Drosophila_2:1639476_at:399:511; Interrogation_Position=242; Antisense; GTGAAGTCTTCACGCGAGAGGATCA
>probe:Drosophila_2:1639476_at:676:425; Interrogation_Position=257; Antisense; GAGAGGATCAGTGCGTCCGCATCCA
>probe:Drosophila_2:1639476_at:179:561; Interrogation_Position=288; Antisense; GGAAACGCTGCAACTCTGGGAGGAT
>probe:Drosophila_2:1639476_at:294:611; Interrogation_Position=332; Antisense; TGACGCAGGGCAATTGCACGCCAGT
>probe:Drosophila_2:1639476_at:592:445; Interrogation_Position=389; Antisense; GATGCTGCCCACTGTATGAGTGCAA
>probe:Drosophila_2:1639476_at:344:415; Interrogation_Position=463; Antisense; GACCACTATGGTACTCTGCGATCAT
>probe:Drosophila_2:1639476_at:712:623; Interrogation_Position=479; Antisense; TGCGATCATCCCATCTCACTGAGAT
>probe:Drosophila_2:1639476_at:469:13; Interrogation_Position=541; Antisense; ATTCACACGGCGTCGGCGAGGAAGT
>probe:Drosophila_2:1639476_at:591:195; Interrogation_Position=583; Antisense; AACTGGTACTCTGTTCCTAGGACTA

Paste this into a BLAST search page for me
GTCATTGATCATCGGTGGCAGCCAAGGCAGCCAAGCGATTCCTTATCGACACCCTCGGCGTATCTGTACAATCAGGTATGGATACATTGACGGGTCGGCAGGGTCGGCAGCTTTATATCGGTGAAGTGAAGTCTTCACGCGAGAGGATCAGAGAGGATCAGTGCGTCCGCATCCAGGAAACGCTGCAACTCTGGGAGGATTGACGCAGGGCAATTGCACGCCAGTGATGCTGCCCACTGTATGAGTGCAAGACCACTATGGTACTCTGCGATCATTGCGATCATCCCATCTCACTGAGATATTCACACGGCGTCGGCGAGGAAGTAACTGGTACTCTGTTCCTAGGACTA

Full Affymetrix probeset data:

Annotations for 1639476_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720