Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639477_s_at:

>probe:Drosophila_2:1639477_s_at:477:629; Interrogation_Position=118; Antisense; TCACGGTCGGACAATTACATAACTT
>probe:Drosophila_2:1639477_s_at:261:109; Interrogation_Position=145; Antisense; AGAAGAAACCATGTCGCAGGCTCCC
>probe:Drosophila_2:1639477_s_at:708:451; Interrogation_Position=187; Antisense; GATCAAGTTCGGCAGATGGTCCCTG
>probe:Drosophila_2:1639477_s_at:125:265; Interrogation_Position=245; Antisense; CAGAGCCGCCTGTCCAAGAAGGAGG
>probe:Drosophila_2:1639477_s_at:690:303; Interrogation_Position=307; Antisense; CCGTGATGCCAAGCTCGCCGAGGAG
>probe:Drosophila_2:1639477_s_at:381:727; Interrogation_Position=365; Antisense; TTGGCTGAGCTTTCGAAGCCCACTC
>probe:Drosophila_2:1639477_s_at:388:633; Interrogation_Position=388; Antisense; TCCCAAGCACTAGGATCCTTCAGGA
>probe:Drosophila_2:1639477_s_at:697:39; Interrogation_Position=40; Antisense; ATCGATAGCCGCCTGTCAGTTTTGA
>probe:Drosophila_2:1639477_s_at:635:151; Interrogation_Position=417; Antisense; ACATCCGCAGTTCCCTTAGCTTAAA
>probe:Drosophila_2:1639477_s_at:73:77; Interrogation_Position=488; Antisense; AGGAGCATCATCGATAGTGGAGCCA
>probe:Drosophila_2:1639477_s_at:146:555; Interrogation_Position=506; Antisense; GGAGCCACCATCTATCGATCACTGA
>probe:Drosophila_2:1639477_s_at:278:403; Interrogation_Position=529; Antisense; GACTATCGTTTTTGTGTTTTCCTCT
>probe:Drosophila_2:1639477_s_at:664:601; Interrogation_Position=543; Antisense; TGTTTTCCTCTGATGCTTGTGCAAA
>probe:Drosophila_2:1639477_s_at:576:697; Interrogation_Position=72; Antisense; TTTAAGGTTATACTGCGCTGCCGTT

Paste this into a BLAST search page for me
TCACGGTCGGACAATTACATAACTTAGAAGAAACCATGTCGCAGGCTCCCGATCAAGTTCGGCAGATGGTCCCTGCAGAGCCGCCTGTCCAAGAAGGAGGCCGTGATGCCAAGCTCGCCGAGGAGTTGGCTGAGCTTTCGAAGCCCACTCTCCCAAGCACTAGGATCCTTCAGGAATCGATAGCCGCCTGTCAGTTTTGAACATCCGCAGTTCCCTTAGCTTAAAAGGAGCATCATCGATAGTGGAGCCAGGAGCCACCATCTATCGATCACTGAGACTATCGTTTTTGTGTTTTCCTCTTGTTTTCCTCTGATGCTTGTGCAAATTTAAGGTTATACTGCGCTGCCGTT

Full Affymetrix probeset data:

Annotations for 1639477_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime