FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639478_at:

>probe:Drosophila_2:1639478_at:525:141; Interrogation_Position=1105; Antisense; ACTGGTGGCCAGTACTTGGACTACC
>probe:Drosophila_2:1639478_at:483:585; Interrogation_Position=1121; Antisense; TGGACTACCCGCCATTGGAAAAGGT
>probe:Drosophila_2:1639478_at:398:247; Interrogation_Position=1156; Antisense; AATTGCAACGTGTCGACTTTGCCGA
>probe:Drosophila_2:1639478_at:93:107; Interrogation_Position=1182; Antisense; AGAACTACTAGTGCGCTGGGATAAA
>probe:Drosophila_2:1639478_at:287:287; Interrogation_Position=1216; Antisense; CTGGATCTTAGATTCAACCCGTGGA
>probe:Drosophila_2:1639478_at:211:325; Interrogation_Position=1244; Antisense; GCGACGAATCCAATGACTTCTTGAT
>probe:Drosophila_2:1639478_at:212:215; Interrogation_Position=1316; Antisense; AAGATGTCAAATGTGGCGGTCCGAA
>probe:Drosophila_2:1639478_at:452:709; Interrogation_Position=1345; Antisense; TTAAACGATGTTACGCTGCTCAGAG
>probe:Drosophila_2:1639478_at:69:467; Interrogation_Position=1417; Antisense; GTTGGACTCTTGGTTGTCCTGCTCA
>probe:Drosophila_2:1639478_at:19:297; Interrogation_Position=1451; Antisense; CGACCATCATTGGTGCTTACGTGAT
>probe:Drosophila_2:1639478_at:244:327; Interrogation_Position=1487; Antisense; GCTGCTTTGGCGTCTTTAGACGTCA
>probe:Drosophila_2:1639478_at:543:103; Interrogation_Position=1504; Antisense; AGACGTCATGACAGCGGTGCTAGCA
>probe:Drosophila_2:1639478_at:255:535; Interrogation_Position=1519; Antisense; GGTGCTAGCAGTGCTCTCTATAATA
>probe:Drosophila_2:1639478_at:64:127; Interrogation_Position=1599; Antisense; AGCCTTGAAGCCTTATTATTCTGTT

Paste this into a BLAST search page for me
ACTGGTGGCCAGTACTTGGACTACCTGGACTACCCGCCATTGGAAAAGGTAATTGCAACGTGTCGACTTTGCCGAAGAACTACTAGTGCGCTGGGATAAACTGGATCTTAGATTCAACCCGTGGAGCGACGAATCCAATGACTTCTTGATAAGATGTCAAATGTGGCGGTCCGAATTAAACGATGTTACGCTGCTCAGAGGTTGGACTCTTGGTTGTCCTGCTCACGACCATCATTGGTGCTTACGTGATGCTGCTTTGGCGTCTTTAGACGTCAAGACGTCATGACAGCGGTGCTAGCAGGTGCTAGCAGTGCTCTCTATAATAAGCCTTGAAGCCTTATTATTCTGTT

Full Affymetrix probeset data:

Annotations for 1639478_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720