Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639480_at:

>probe:Drosophila_2:1639480_at:100:589; Interrogation_Position=1470; Antisense; TGGAGATGTCTACCGCTACAGCAGC
>probe:Drosophila_2:1639480_at:650:155; Interrogation_Position=1487; Antisense; ACAGCAGCGGCGACACCGAGGACAA
>probe:Drosophila_2:1639480_at:395:403; Interrogation_Position=1528; Antisense; GACTTCTGGGTGCATGTGCTCGACA
>probe:Drosophila_2:1639480_at:220:63; Interrogation_Position=1541; Antisense; ATGTGCTCGACAAGTGCGCCAAGAA
>probe:Drosophila_2:1639480_at:580:509; Interrogation_Position=1573; Antisense; GTGCAGAACATTGCCGGCCATTTGA
>probe:Drosophila_2:1639480_at:203:201; Interrogation_Position=1600; Antisense; AACGCCAGCCAGTTCTTGCAGGAGC
>probe:Drosophila_2:1639480_at:457:75; Interrogation_Position=1619; Antisense; AGGAGCGGGCCGTCAAGAACTTCAC
>probe:Drosophila_2:1639480_at:546:79; Interrogation_Position=1646; Antisense; AGGTGCACGCCGATTTCGGTCGCAT
>probe:Drosophila_2:1639480_at:119:503; Interrogation_Position=1664; Antisense; GTCGCATGCTGACCGAGGAACTCAA
>probe:Drosophila_2:1639480_at:611:579; Interrogation_Position=1691; Antisense; TGGCCAAGTCCTCGAAGTTCTAAGC
>probe:Drosophila_2:1639480_at:563:9; Interrogation_Position=1727; Antisense; ATTCGACGGATCAGACTTGGTTTTT
>probe:Drosophila_2:1639480_at:437:391; Interrogation_Position=1839; Antisense; GAAAGGCGAACGCTTTTCGGATCTT
>probe:Drosophila_2:1639480_at:428:715; Interrogation_Position=1854; Antisense; TTCGGATCTTTGGTTGCGGGCTTAA
>probe:Drosophila_2:1639480_at:446:309; Interrogation_Position=1889; Antisense; CCACGAAATGTGTCTTGTCTTGTTT

Paste this into a BLAST search page for me
TGGAGATGTCTACCGCTACAGCAGCACAGCAGCGGCGACACCGAGGACAAGACTTCTGGGTGCATGTGCTCGACAATGTGCTCGACAAGTGCGCCAAGAAGTGCAGAACATTGCCGGCCATTTGAAACGCCAGCCAGTTCTTGCAGGAGCAGGAGCGGGCCGTCAAGAACTTCACAGGTGCACGCCGATTTCGGTCGCATGTCGCATGCTGACCGAGGAACTCAATGGCCAAGTCCTCGAAGTTCTAAGCATTCGACGGATCAGACTTGGTTTTTGAAAGGCGAACGCTTTTCGGATCTTTTCGGATCTTTGGTTGCGGGCTTAACCACGAAATGTGTCTTGTCTTGTTT

Full Affymetrix probeset data:

Annotations for 1639480_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime