FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639481_at:

>probe:Drosophila_2:1639481_at:40:215; Interrogation_Position=1014; Antisense; AAGAGTCAAGGCTTCTGCTTCGAAA
>probe:Drosophila_2:1639481_at:370:717; Interrogation_Position=1032; Antisense; TTCGAAAGCCGTGCTCAAGAGCCAC
>probe:Drosophila_2:1639481_at:482:59; Interrogation_Position=1094; Antisense; ATGTTGAGCCTGTTCCTAAGCGGAC
>probe:Drosophila_2:1639481_at:595:131; Interrogation_Position=1124; Antisense; ACCGAGTGTATTATGGCGATCCGCT
>probe:Drosophila_2:1639481_at:546:533; Interrogation_Position=1152; Antisense; GGTGCTCCTGCACGAACCATTTAAT
>probe:Drosophila_2:1639481_at:562:81; Interrogation_Position=1250; Antisense; AGGGAAATATCCGTCGCTACCGGCG
>probe:Drosophila_2:1639481_at:544:577; Interrogation_Position=1271; Antisense; GGCGCCAAACCGTAGAGCAGATGAT
>probe:Drosophila_2:1639481_at:20:177; Interrogation_Position=1350; Antisense; AAACGATTCCGTGAATGCGCAGCCC
>probe:Drosophila_2:1639481_at:139:625; Interrogation_Position=1365; Antisense; TGCGCAGCCCATGTTTGGTCAGGAA
>probe:Drosophila_2:1639481_at:472:475; Interrogation_Position=805; Antisense; GTTTTCACGGATTCTTTAGCTTTAG
>probe:Drosophila_2:1639481_at:126:299; Interrogation_Position=846; Antisense; CGCCAAATTGCTCATTCGCGTTAAT
>probe:Drosophila_2:1639481_at:703:211; Interrogation_Position=874; Antisense; AAGACTTATCTGACGCGCGATACTG
>probe:Drosophila_2:1639481_at:149:259; Interrogation_Position=968; Antisense; CACGGCATAGCATCAAGGCCAATGT
>probe:Drosophila_2:1639481_at:573:69; Interrogation_Position=983; Antisense; AGGCCAATGTAAATTCCGATTCGTA

Paste this into a BLAST search page for me
AAGAGTCAAGGCTTCTGCTTCGAAATTCGAAAGCCGTGCTCAAGAGCCACATGTTGAGCCTGTTCCTAAGCGGACACCGAGTGTATTATGGCGATCCGCTGGTGCTCCTGCACGAACCATTTAATAGGGAAATATCCGTCGCTACCGGCGGGCGCCAAACCGTAGAGCAGATGATAAACGATTCCGTGAATGCGCAGCCCTGCGCAGCCCATGTTTGGTCAGGAAGTTTTCACGGATTCTTTAGCTTTAGCGCCAAATTGCTCATTCGCGTTAATAAGACTTATCTGACGCGCGATACTGCACGGCATAGCATCAAGGCCAATGTAGGCCAATGTAAATTCCGATTCGTA

Full Affymetrix probeset data:

Annotations for 1639481_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720