Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639484_at:

>probe:Drosophila_2:1639484_at:371:549; Interrogation_Position=1018; Antisense; GGAGGACTCTTTCCAGATGAGCACT
>probe:Drosophila_2:1639484_at:403:497; Interrogation_Position=1082; Antisense; GTCTTCGGAGGCTTCCTCATGCGAA
>probe:Drosophila_2:1639484_at:506:305; Interrogation_Position=1096; Antisense; CCTCATGCGAAGTGCCCTGGAGATA
>probe:Drosophila_2:1639484_at:682:355; Interrogation_Position=1168; Antisense; GCACATATCCGACATCAGCTTCGAG
>probe:Drosophila_2:1639484_at:351:669; Interrogation_Position=1256; Antisense; TACGTGCAGATCATGACCGTTGCAG
>probe:Drosophila_2:1639484_at:386:413; Interrogation_Position=1270; Antisense; GACCGTTGCAGATGTGATGGACCCA
>probe:Drosophila_2:1639484_at:610:175; Interrogation_Position=1296; Antisense; AAACGGGCAGCCAGGTGACCACCAA
>probe:Drosophila_2:1639484_at:656:537; Interrogation_Position=1395; Antisense; GGTACATCCAAGGTCGTCGAAAGTT
>probe:Drosophila_2:1639484_at:431:63; Interrogation_Position=1430; Antisense; ATGGGCCCAGTGTAGACATGGTTCA
>probe:Drosophila_2:1639484_at:343:541; Interrogation_Position=1449; Antisense; GGTTCAGCCTGTGATTGTTACTCAA
>probe:Drosophila_2:1639484_at:728:701; Interrogation_Position=1478; Antisense; TTATGCAAGGCTATCCTACCAGATA
>probe:Drosophila_2:1639484_at:624:361; Interrogation_Position=1506; Antisense; GCAATTACCAGTTCAGTGTTTACAA
>probe:Drosophila_2:1639484_at:480:729; Interrogation_Position=974; Antisense; TTGGAACTCAACAAGCGCATCCTGC
>probe:Drosophila_2:1639484_at:534:627; Interrogation_Position=996; Antisense; TGCCACCAAACTGTCGCTGGATGGA

Paste this into a BLAST search page for me
GGAGGACTCTTTCCAGATGAGCACTGTCTTCGGAGGCTTCCTCATGCGAACCTCATGCGAAGTGCCCTGGAGATAGCACATATCCGACATCAGCTTCGAGTACGTGCAGATCATGACCGTTGCAGGACCGTTGCAGATGTGATGGACCCAAAACGGGCAGCCAGGTGACCACCAAGGTACATCCAAGGTCGTCGAAAGTTATGGGCCCAGTGTAGACATGGTTCAGGTTCAGCCTGTGATTGTTACTCAATTATGCAAGGCTATCCTACCAGATAGCAATTACCAGTTCAGTGTTTACAATTGGAACTCAACAAGCGCATCCTGCTGCCACCAAACTGTCGCTGGATGGA

Full Affymetrix probeset data:

Annotations for 1639484_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime