FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639485_at:

>probe:Drosophila_2:1639485_at:17:377; Interrogation_Position=259; Antisense; GAAGACACCAGACACGCGAAGATCG
>probe:Drosophila_2:1639485_at:461:611; Interrogation_Position=303; Antisense; TGACGACGAGAGTGTGCCCGATTAC
>probe:Drosophila_2:1639485_at:311:461; Interrogation_Position=322; Antisense; GATTACGATCCTCAGGTCTACTGTT
>probe:Drosophila_2:1639485_at:487:535; Interrogation_Position=336; Antisense; GGTCTACTGTTCCAGGGCCAACATA
>probe:Drosophila_2:1639485_at:431:81; Interrogation_Position=364; Antisense; AGAGAGCCCAATGGGTTGTTTCCCG
>probe:Drosophila_2:1639485_at:231:121; Interrogation_Position=392; Antisense; AGCGAAGGGCTTTCATCGAGCAGGA
>probe:Drosophila_2:1639485_at:182:177; Interrogation_Position=418; Antisense; AAACGTCGTCACTTTGGCGAGGATT
>probe:Drosophila_2:1639485_at:329:439; Interrogation_Position=513; Antisense; GAGGCCATACTCAAGGCGCCAGTAG
>probe:Drosophila_2:1639485_at:492:321; Interrogation_Position=528; Antisense; GCGCCAGTAGTTCGTGTTCATCAAG
>probe:Drosophila_2:1639485_at:109:473; Interrogation_Position=543; Antisense; GTTCATCAAGAATTACTCCCACTGC
>probe:Drosophila_2:1639485_at:481:185; Interrogation_Position=670; Antisense; AACAAGTATTGCTCGCAGTTCAGAT
>probe:Drosophila_2:1639485_at:139:509; Interrogation_Position=770; Antisense; GTGTAAACTATGTGCCTTTTTCCAT
>probe:Drosophila_2:1639485_at:27:315; Interrogation_Position=783; Antisense; GCCTTTTTCCATTAACGACACAGAT
>probe:Drosophila_2:1639485_at:717:115; Interrogation_Position=821; Antisense; AGCATTTCACTTTGTTTCTTATCAA

Paste this into a BLAST search page for me
GAAGACACCAGACACGCGAAGATCGTGACGACGAGAGTGTGCCCGATTACGATTACGATCCTCAGGTCTACTGTTGGTCTACTGTTCCAGGGCCAACATAAGAGAGCCCAATGGGTTGTTTCCCGAGCGAAGGGCTTTCATCGAGCAGGAAAACGTCGTCACTTTGGCGAGGATTGAGGCCATACTCAAGGCGCCAGTAGGCGCCAGTAGTTCGTGTTCATCAAGGTTCATCAAGAATTACTCCCACTGCAACAAGTATTGCTCGCAGTTCAGATGTGTAAACTATGTGCCTTTTTCCATGCCTTTTTCCATTAACGACACAGATAGCATTTCACTTTGTTTCTTATCAA

Full Affymetrix probeset data:

Annotations for 1639485_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720