Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639487_at:

>probe:Drosophila_2:1639487_at:374:89; Interrogation_Position=104; Antisense; AGTCAGCATACTTGTGGCCTTTGTG
>probe:Drosophila_2:1639487_at:200:511; Interrogation_Position=132; Antisense; GTGCAAATTGCTGATTCCCTGAAGT
>probe:Drosophila_2:1639487_at:685:73; Interrogation_Position=154; Antisense; AGTGTTACACCTGCGTAACGCCAAA
>probe:Drosophila_2:1639487_at:362:393; Interrogation_Position=197; Antisense; GAAAGTCACCTGCACGAATGCGGCT
>probe:Drosophila_2:1639487_at:685:473; Interrogation_Position=235; Antisense; GTTACTACCTGGGTGTCTATCATCA
>probe:Drosophila_2:1639487_at:323:203; Interrogation_Position=270; Antisense; AACCTAACCAGCACGCGATTCGATT
>probe:Drosophila_2:1639487_at:93:465; Interrogation_Position=291; Antisense; GATTGCCTGGCTCTGAAGTACAACT
>probe:Drosophila_2:1639487_at:667:117; Interrogation_Position=337; Antisense; AGCTCCATGGCTGTGTGCATCCAAA
>probe:Drosophila_2:1639487_at:423:587; Interrogation_Position=365; Antisense; TGGAGCCTGCAGCTTAGCACTTAAG
>probe:Drosophila_2:1639487_at:312:305; Interrogation_Position=390; Antisense; CCGGCCTATGCTCACTACAATAAGA
>probe:Drosophila_2:1639487_at:722:239; Interrogation_Position=408; Antisense; AATAAGACCTGGTGTCTCACCTGTT
>probe:Drosophila_2:1639487_at:140:221; Interrogation_Position=441; Antisense; AAGTGCAACAAGAATCCGGCCGGAA
>probe:Drosophila_2:1639487_at:162:715; Interrogation_Position=502; Antisense; TTCTGGGTCTCTTGCTGGTCAAGAT
>probe:Drosophila_2:1639487_at:196:229; Interrogation_Position=521; Antisense; CAAGATGTATGCCTAGTGTGACTAT

Paste this into a BLAST search page for me
AGTCAGCATACTTGTGGCCTTTGTGGTGCAAATTGCTGATTCCCTGAAGTAGTGTTACACCTGCGTAACGCCAAAGAAAGTCACCTGCACGAATGCGGCTGTTACTACCTGGGTGTCTATCATCAAACCTAACCAGCACGCGATTCGATTGATTGCCTGGCTCTGAAGTACAACTAGCTCCATGGCTGTGTGCATCCAAATGGAGCCTGCAGCTTAGCACTTAAGCCGGCCTATGCTCACTACAATAAGAAATAAGACCTGGTGTCTCACCTGTTAAGTGCAACAAGAATCCGGCCGGAATTCTGGGTCTCTTGCTGGTCAAGATCAAGATGTATGCCTAGTGTGACTAT

Full Affymetrix probeset data:

Annotations for 1639487_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime