Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639488_at:

>probe:Drosophila_2:1639488_at:304:499; Interrogation_Position=1081; Antisense; GTCGGCGGTGCCAATGGACACTTTG
>probe:Drosophila_2:1639488_at:600:311; Interrogation_Position=1090; Antisense; GCCAATGGACACTTTGAGCTCAACG
>probe:Drosophila_2:1639488_at:296:419; Interrogation_Position=1105; Antisense; GAGCTCAACGTTTTCAAGCCACTGA
>probe:Drosophila_2:1639488_at:414:127; Interrogation_Position=1121; Antisense; AGCCACTGATCGCATCCAATGTGCT
>probe:Drosophila_2:1639488_at:2:209; Interrogation_Position=1156; Antisense; AAGCTGCTGGCTGATGGGTGCATCA
>probe:Drosophila_2:1639488_at:104:193; Interrogation_Position=1186; Antisense; AACTGCAACTGCGTCAAGGGCATTA
>probe:Drosophila_2:1639488_at:347:551; Interrogation_Position=1221; Antisense; GGAGAAGCTGGCAAAGATCGTGAAT
>probe:Drosophila_2:1639488_at:222:451; Interrogation_Position=1236; Antisense; GATCGTGAATGAGTCGCTAATGCTG
>probe:Drosophila_2:1639488_at:277:339; Interrogation_Position=1251; Antisense; GCTAATGCTGGTGACAGCCCTCAAT
>probe:Drosophila_2:1639488_at:124:571; Interrogation_Position=1285; Antisense; GGCTATGACAAGTCCGCCCAGATTG
>probe:Drosophila_2:1639488_at:675:221; Interrogation_Position=1312; Antisense; AAGGCGGCCCACAAGAATGGAACTA
>probe:Drosophila_2:1639488_at:265:589; Interrogation_Position=1346; Antisense; TGGAGGCATTGAACGCCGGCATATC
>probe:Drosophila_2:1639488_at:149:215; Interrogation_Position=1405; Antisense; AAGATGCTGGGTCCTTCTTAGGTTT
>probe:Drosophila_2:1639488_at:123:283; Interrogation_Position=1432; Antisense; CTCCCTTGTTCCATGTGTTACACAT

Paste this into a BLAST search page for me
GTCGGCGGTGCCAATGGACACTTTGGCCAATGGACACTTTGAGCTCAACGGAGCTCAACGTTTTCAAGCCACTGAAGCCACTGATCGCATCCAATGTGCTAAGCTGCTGGCTGATGGGTGCATCAAACTGCAACTGCGTCAAGGGCATTAGGAGAAGCTGGCAAAGATCGTGAATGATCGTGAATGAGTCGCTAATGCTGGCTAATGCTGGTGACAGCCCTCAATGGCTATGACAAGTCCGCCCAGATTGAAGGCGGCCCACAAGAATGGAACTATGGAGGCATTGAACGCCGGCATATCAAGATGCTGGGTCCTTCTTAGGTTTCTCCCTTGTTCCATGTGTTACACAT

Full Affymetrix probeset data:

Annotations for 1639488_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime