Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639489_at:

>probe:Drosophila_2:1639489_at:431:1; Interrogation_Position=1007; Antisense; ATTAGTTTGTGGCTCCCAAGGACTC
>probe:Drosophila_2:1639489_at:70:403; Interrogation_Position=1027; Antisense; GACTCCCGAGTGTCTATACCAAAGT
>probe:Drosophila_2:1639489_at:4:607; Interrogation_Position=569; Antisense; TGATGCTCTGGTTCAGGACTTTCGG
>probe:Drosophila_2:1639489_at:445:147; Interrogation_Position=586; Antisense; ACTTTCGGGTGGTCAACTATGTGGT
>probe:Drosophila_2:1639489_at:209:593; Interrogation_Position=605; Antisense; TGTGGTGCACCCTGGATATGATACT
>probe:Drosophila_2:1639489_at:274:7; Interrogation_Position=660; Antisense; ATTGCCCTGGTGGAACTGGATCGGA
>probe:Drosophila_2:1639489_at:173:573; Interrogation_Position=686; Antisense; GGCTGAGTTCAACGACCATGTGGCA
>probe:Drosophila_2:1639489_at:656:193; Interrogation_Position=738; Antisense; AACGATGTTCAGCAGGTCACAGCCG
>probe:Drosophila_2:1639489_at:443:615; Interrogation_Position=790; Antisense; TGAAGTCCTCGCACCTGCTGAAGGT
>probe:Drosophila_2:1639489_at:609:221; Interrogation_Position=810; Antisense; AAGGTCAACCTCCAGCGATTCAGTG
>probe:Drosophila_2:1639489_at:521:293; Interrogation_Position=825; Antisense; CGATTCAGTGACGAGGTGTGCCAGA
>probe:Drosophila_2:1639489_at:676:205; Interrogation_Position=849; Antisense; AAGCGCCTGCGTTTCAGCATCGATA
>probe:Drosophila_2:1639489_at:194:575; Interrogation_Position=936; Antisense; GGCGGACCTATATTCGTCCAGCATC
>probe:Drosophila_2:1639489_at:556:349; Interrogation_Position=980; Antisense; GCAGGTCATAGGGATTGTCTCATAT

Paste this into a BLAST search page for me
ATTAGTTTGTGGCTCCCAAGGACTCGACTCCCGAGTGTCTATACCAAAGTTGATGCTCTGGTTCAGGACTTTCGGACTTTCGGGTGGTCAACTATGTGGTTGTGGTGCACCCTGGATATGATACTATTGCCCTGGTGGAACTGGATCGGAGGCTGAGTTCAACGACCATGTGGCAAACGATGTTCAGCAGGTCACAGCCGTGAAGTCCTCGCACCTGCTGAAGGTAAGGTCAACCTCCAGCGATTCAGTGCGATTCAGTGACGAGGTGTGCCAGAAAGCGCCTGCGTTTCAGCATCGATAGGCGGACCTATATTCGTCCAGCATCGCAGGTCATAGGGATTGTCTCATAT

Full Affymetrix probeset data:

Annotations for 1639489_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime