Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639490_at:

>probe:Drosophila_2:1639490_at:647:639; Interrogation_Position=8003; Antisense; TCACCATAAATCACCGTTACCGTTA
>probe:Drosophila_2:1639490_at:623:287; Interrogation_Position=8035; Antisense; CGTTACTTCAACGTAGTTTTCACAT
>probe:Drosophila_2:1639490_at:428:485; Interrogation_Position=8047; Antisense; GTAGTTTTCACATAGACTCGTATAA
>probe:Drosophila_2:1639490_at:459:687; Interrogation_Position=8078; Antisense; TATAGTAACCATTCGCCAGTGCTGT
>probe:Drosophila_2:1639490_at:608:597; Interrogation_Position=8100; Antisense; TGTCAGCCCGGCAGCCAAATAGCAA
>probe:Drosophila_2:1639490_at:185:557; Interrogation_Position=8134; Antisense; GGACATCCTGCAGCGGCGGATTCCA
>probe:Drosophila_2:1639490_at:698:541; Interrogation_Position=8151; Antisense; GGATTCCAGAGGAGGCCGCCCGATC
>probe:Drosophila_2:1639490_at:161:647; Interrogation_Position=8177; Antisense; TCATTCGGCATGTCGCTGGCCTAAG
>probe:Drosophila_2:1639490_at:343:269; Interrogation_Position=8185; Antisense; CATGTCGCTGGCCTAAGCTAAGTCC
>probe:Drosophila_2:1639490_at:435:117; Interrogation_Position=8200; Antisense; AGCTAAGTCCACATCTGTTGTTTTT
>probe:Drosophila_2:1639490_at:418:601; Interrogation_Position=8215; Antisense; TGTTGTTTTTCTATTCTACGGCGGC
>probe:Drosophila_2:1639490_at:399:709; Interrogation_Position=8228; Antisense; TTCTACGGCGGCGAAAGACTTTGGA
>probe:Drosophila_2:1639490_at:649:405; Interrogation_Position=8373; Antisense; GACGTAACTACGGAATACAGCTAAA
>probe:Drosophila_2:1639490_at:151:703; Interrogation_Position=8497; Antisense; TTATTACACACCTAAGATCACTATT

Paste this into a BLAST search page for me
TCACCATAAATCACCGTTACCGTTACGTTACTTCAACGTAGTTTTCACATGTAGTTTTCACATAGACTCGTATAATATAGTAACCATTCGCCAGTGCTGTTGTCAGCCCGGCAGCCAAATAGCAAGGACATCCTGCAGCGGCGGATTCCAGGATTCCAGAGGAGGCCGCCCGATCTCATTCGGCATGTCGCTGGCCTAAGCATGTCGCTGGCCTAAGCTAAGTCCAGCTAAGTCCACATCTGTTGTTTTTTGTTGTTTTTCTATTCTACGGCGGCTTCTACGGCGGCGAAAGACTTTGGAGACGTAACTACGGAATACAGCTAAATTATTACACACCTAAGATCACTATT

Full Affymetrix probeset data:

Annotations for 1639490_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime