FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639491_at:

>probe:Drosophila_2:1639491_at:674:277; Interrogation_Position=140; Antisense; CTACATCGCCAAGCCAGAGTTCTAT
>probe:Drosophila_2:1639491_at:530:101; Interrogation_Position=155; Antisense; AGAGTTCTATTCGACTGTTCCAGCG
>probe:Drosophila_2:1639491_at:605:253; Interrogation_Position=192; Antisense; CAACGCCTTTTCTATGTGCAATACA
>probe:Drosophila_2:1639491_at:662:587; Interrogation_Position=235; Antisense; TGGAGACTGACCTCACAGCAGTGTT
>probe:Drosophila_2:1639491_at:558:475; Interrogation_Position=255; Antisense; GTGTTAACCCGTTTGGAGGCTGCCA
>probe:Drosophila_2:1639491_at:2:227; Interrogation_Position=324; Antisense; AAGGAAGTTCACAGCCTCGTGCAAA
>probe:Drosophila_2:1639491_at:374:593; Interrogation_Position=369; Antisense; TGGGTGAGCATACCGCCAGTGCAAA
>probe:Drosophila_2:1639491_at:633:195; Interrogation_Position=393; Antisense; AAGGTTACCCTTCAAGTGGGCGCAT
>probe:Drosophila_2:1639491_at:209:595; Interrogation_Position=409; Antisense; TGGGCGCATCTCTGCAAATGGAATT
>probe:Drosophila_2:1639491_at:683:225; Interrogation_Position=425; Antisense; AATGGAATTCGAGCTGTCCGAGGCG
>probe:Drosophila_2:1639491_at:704:425; Interrogation_Position=546; Antisense; GAGATGAACCTAGCCGTATTGTATA
>probe:Drosophila_2:1639491_at:16:553; Interrogation_Position=581; Antisense; GGAGAACTAGAAGCATCCCACCATC
>probe:Drosophila_2:1639491_at:192:281; Interrogation_Position=76; Antisense; CTCTGGGCGGCCGAAAGTCATTTAT
>probe:Drosophila_2:1639491_at:557:169; Interrogation_Position=89; Antisense; AAAGTCATTTATGCCCATCCCAGAG

Paste this into a BLAST search page for me
CTACATCGCCAAGCCAGAGTTCTATAGAGTTCTATTCGACTGTTCCAGCGCAACGCCTTTTCTATGTGCAATACATGGAGACTGACCTCACAGCAGTGTTGTGTTAACCCGTTTGGAGGCTGCCAAAGGAAGTTCACAGCCTCGTGCAAATGGGTGAGCATACCGCCAGTGCAAAAAGGTTACCCTTCAAGTGGGCGCATTGGGCGCATCTCTGCAAATGGAATTAATGGAATTCGAGCTGTCCGAGGCGGAGATGAACCTAGCCGTATTGTATAGGAGAACTAGAAGCATCCCACCATCCTCTGGGCGGCCGAAAGTCATTTATAAAGTCATTTATGCCCATCCCAGAG

Full Affymetrix probeset data:

Annotations for 1639491_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720