Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639492_at:

>probe:Drosophila_2:1639492_at:431:217; Interrogation_Position=2763; Antisense; AAGTCTAAGTGCGTCAGTGGCTCTT
>probe:Drosophila_2:1639492_at:483:571; Interrogation_Position=2781; Antisense; GGCTCTTGTATGTCTTTATTCACCT
>probe:Drosophila_2:1639492_at:319:171; Interrogation_Position=2806; Antisense; AAAGTATACATCCTCGTCTTTCACC
>probe:Drosophila_2:1639492_at:433:369; Interrogation_Position=2838; Antisense; GAATGTCCGCAAGCTGACTATGAAC
>probe:Drosophila_2:1639492_at:348:55; Interrogation_Position=2857; Antisense; ATGAACAGCACCGTCTACAGGCGAT
>probe:Drosophila_2:1639492_at:515:203; Interrogation_Position=2910; Antisense; AACCAGCTCTGGATATAGTCGCACA
>probe:Drosophila_2:1639492_at:103:687; Interrogation_Position=2923; Antisense; TATAGTCGCACACATGCACCAGGCA
>probe:Drosophila_2:1639492_at:510:127; Interrogation_Position=2940; Antisense; ACCAGGCACTTCTGCGCTAACAGGA
>probe:Drosophila_2:1639492_at:133:159; Interrogation_Position=2977; Antisense; ACAAATGCGTCTTCAAGTACCCTTC
>probe:Drosophila_2:1639492_at:187:291; Interrogation_Position=2989; Antisense; TCAAGTACCCTTCCGACACAAAATA
>probe:Drosophila_2:1639492_at:2:695; Interrogation_Position=3073; Antisense; TTTCTACCCGAAGTTGGCGAACGCG
>probe:Drosophila_2:1639492_at:101:201; Interrogation_Position=3092; Antisense; AACGCGTTGAGCCAATCTGTCATAT
>probe:Drosophila_2:1639492_at:110:609; Interrogation_Position=3213; Antisense; TACACAGGTCCTCAACGTTAGAAAA
>probe:Drosophila_2:1639492_at:582:703; Interrogation_Position=3298; Antisense; TTATCCGAATCCTAACCTCAAAGTC

Paste this into a BLAST search page for me
AAGTCTAAGTGCGTCAGTGGCTCTTGGCTCTTGTATGTCTTTATTCACCTAAAGTATACATCCTCGTCTTTCACCGAATGTCCGCAAGCTGACTATGAACATGAACAGCACCGTCTACAGGCGATAACCAGCTCTGGATATAGTCGCACATATAGTCGCACACATGCACCAGGCAACCAGGCACTTCTGCGCTAACAGGAACAAATGCGTCTTCAAGTACCCTTCTCAAGTACCCTTCCGACACAAAATATTTCTACCCGAAGTTGGCGAACGCGAACGCGTTGAGCCAATCTGTCATATTACACAGGTCCTCAACGTTAGAAAATTATCCGAATCCTAACCTCAAAGTC

Full Affymetrix probeset data:

Annotations for 1639492_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime