FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639493_at:

>probe:Drosophila_2:1639493_at:74:721; Interrogation_Position=1312; Antisense; TTGCCCAAGGGCGAAGCTGAAATTA
>probe:Drosophila_2:1639493_at:182:163; Interrogation_Position=1340; Antisense; AAATTTCATTTCAAATCACGTTGAG
>probe:Drosophila_2:1639493_at:25:651; Interrogation_Position=1355; Antisense; TCACGTTGAGTGACATGCAGACTGA
>probe:Drosophila_2:1639493_at:109:401; Interrogation_Position=1366; Antisense; GACATGCAGACTGAGCACAGGACAA
>probe:Drosophila_2:1639493_at:12:387; Interrogation_Position=1391; Antisense; GAAAACTTAATCAGCGATGTTAACG
>probe:Drosophila_2:1639493_at:54:61; Interrogation_Position=1407; Antisense; ATGTTAACGATGTCAGGCTGCGGGA
>probe:Drosophila_2:1639493_at:224:269; Interrogation_Position=1420; Antisense; CAGGCTGCGGGAAACAGGATGTCAT
>probe:Drosophila_2:1639493_at:661:153; Interrogation_Position=1433; Antisense; ACAGGATGTCATTCTGTACCATCAA
>probe:Drosophila_2:1639493_at:283:601; Interrogation_Position=1447; Antisense; TGTACCATCAAATGGCTCCATTCCG
>probe:Drosophila_2:1639493_at:468:169; Interrogation_Position=1456; Antisense; AAATGGCTCCATTCCGGGTCGCGTA
>probe:Drosophila_2:1639493_at:692:535; Interrogation_Position=1472; Antisense; GGTCGCGTACTCGTATTTTATTCCG
>probe:Drosophila_2:1639493_at:407:281; Interrogation_Position=1481; Antisense; CTCGTATTTTATTCCGTTCTCTACT
>probe:Drosophila_2:1639493_at:148:473; Interrogation_Position=1496; Antisense; GTTCTCTACTTTCTTTATCCTTAAT
>probe:Drosophila_2:1639493_at:628:713; Interrogation_Position=1545; Antisense; TTCTAATTCATATGCGTTTCAAGTT

Paste this into a BLAST search page for me
TTGCCCAAGGGCGAAGCTGAAATTAAAATTTCATTTCAAATCACGTTGAGTCACGTTGAGTGACATGCAGACTGAGACATGCAGACTGAGCACAGGACAAGAAAACTTAATCAGCGATGTTAACGATGTTAACGATGTCAGGCTGCGGGACAGGCTGCGGGAAACAGGATGTCATACAGGATGTCATTCTGTACCATCAATGTACCATCAAATGGCTCCATTCCGAAATGGCTCCATTCCGGGTCGCGTAGGTCGCGTACTCGTATTTTATTCCGCTCGTATTTTATTCCGTTCTCTACTGTTCTCTACTTTCTTTATCCTTAATTTCTAATTCATATGCGTTTCAAGTT

Full Affymetrix probeset data:

Annotations for 1639493_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720