Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639494_at:

>probe:Drosophila_2:1639494_at:567:249; Interrogation_Position=1503; Antisense; CAATCGGCTAACCACTACCATCAGA
>probe:Drosophila_2:1639494_at:140:263; Interrogation_Position=1557; Antisense; CAGCACAAGGCGCATCCACAGTTGC
>probe:Drosophila_2:1639494_at:154:269; Interrogation_Position=1586; Antisense; CATCCTGCAGCAGCGCATGAGACAG
>probe:Drosophila_2:1639494_at:654:261; Interrogation_Position=1749; Antisense; CACCATTCGCGACCTGTATGACAAA
>probe:Drosophila_2:1639494_at:685:611; Interrogation_Position=1767; Antisense; TGACAAAACCCGTTCTTGGACTAAG
>probe:Drosophila_2:1639494_at:605:265; Interrogation_Position=1811; Antisense; CAGATTTACATAGCAGCCGCTGCCA
>probe:Drosophila_2:1639494_at:16:297; Interrogation_Position=1828; Antisense; CGCTGCCAACACTTCGGAAAGGGTC
>probe:Drosophila_2:1639494_at:690:529; Interrogation_Position=1848; Antisense; GGGTCAATTAGACGACATTTCTTCA
>probe:Drosophila_2:1639494_at:681:509; Interrogation_Position=1892; Antisense; GTGCAGAAAGATCCCACACACACAA
>probe:Drosophila_2:1639494_at:485:651; Interrogation_Position=1920; Antisense; TCACTCTATCAACTCAACTATCAAC
>probe:Drosophila_2:1639494_at:118:147; Interrogation_Position=1943; Antisense; ACTCATAAAGCTTGCCATGGTCCCT
>probe:Drosophila_2:1639494_at:521:65; Interrogation_Position=1959; Antisense; ATGGTCCCTCGTTCTTGATATTGAA
>probe:Drosophila_2:1639494_at:633:497; Interrogation_Position=2035; Antisense; GTCTTTGAATGTAAGCGTACCACTT
>probe:Drosophila_2:1639494_at:696:325; Interrogation_Position=2049; Antisense; GCGTACCACTTTTCACGTTTAATAT

Paste this into a BLAST search page for me
CAATCGGCTAACCACTACCATCAGACAGCACAAGGCGCATCCACAGTTGCCATCCTGCAGCAGCGCATGAGACAGCACCATTCGCGACCTGTATGACAAATGACAAAACCCGTTCTTGGACTAAGCAGATTTACATAGCAGCCGCTGCCACGCTGCCAACACTTCGGAAAGGGTCGGGTCAATTAGACGACATTTCTTCAGTGCAGAAAGATCCCACACACACAATCACTCTATCAACTCAACTATCAACACTCATAAAGCTTGCCATGGTCCCTATGGTCCCTCGTTCTTGATATTGAAGTCTTTGAATGTAAGCGTACCACTTGCGTACCACTTTTCACGTTTAATAT

Full Affymetrix probeset data:

Annotations for 1639494_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime