FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639495_at:

>probe:Drosophila_2:1639495_at:536:311; Interrogation_Position=1177; Antisense; GCCAAGGATTACACGCTCACAGATG
>probe:Drosophila_2:1639495_at:392:369; Interrogation_Position=1204; Antisense; GAAGGCACCAAGCTTTTCGAGTTTA
>probe:Drosophila_2:1639495_at:367:191; Interrogation_Position=1246; Antisense; AACATTCCCATCTGTGGGTTGCACT
>probe:Drosophila_2:1639495_at:458:469; Interrogation_Position=1263; Antisense; GTTGCACTGGGATGAGCGCTTCTTT
>probe:Drosophila_2:1639495_at:582:433; Interrogation_Position=1299; Antisense; GAGGTTTGACCCAGAGCGATTTAGC
>probe:Drosophila_2:1639495_at:91:457; Interrogation_Position=1344; Antisense; GATACCCTACACATATTTGCCATTT
>probe:Drosophila_2:1639495_at:481:15; Interrogation_Position=1358; Antisense; ATTTGCCATTTGGAGTCGGACCCCG
>probe:Drosophila_2:1639495_at:284:45; Interrogation_Position=1397; Antisense; ATCGCTATGCTGTGATGCAGGCCAA
>probe:Drosophila_2:1639495_at:565:579; Interrogation_Position=1416; Antisense; GGCCAAGGGTATGCTCTACAATCTA
>probe:Drosophila_2:1639495_at:133:95; Interrogation_Position=1454; Antisense; AGATTGAGGCGTCACCGAGAACCAC
>probe:Drosophila_2:1639495_at:473:641; Interrogation_Position=1514; Antisense; TAATTCCTACGACCGGATTCTGGAT
>probe:Drosophila_2:1639495_at:437:287; Interrogation_Position=1533; Antisense; CTGGATGCAGTTGGTGTCGCGTAAA
>probe:Drosophila_2:1639495_at:32:45; Interrogation_Position=1572; Antisense; ATCGAATTCCGCTCATATTGTACGA
>probe:Drosophila_2:1639495_at:412:325; Interrogation_Position=1629; Antisense; GCGACAGTCAGATACCCTTTACTTA

Paste this into a BLAST search page for me
GCCAAGGATTACACGCTCACAGATGGAAGGCACCAAGCTTTTCGAGTTTAAACATTCCCATCTGTGGGTTGCACTGTTGCACTGGGATGAGCGCTTCTTTGAGGTTTGACCCAGAGCGATTTAGCGATACCCTACACATATTTGCCATTTATTTGCCATTTGGAGTCGGACCCCGATCGCTATGCTGTGATGCAGGCCAAGGCCAAGGGTATGCTCTACAATCTAAGATTGAGGCGTCACCGAGAACCACTAATTCCTACGACCGGATTCTGGATCTGGATGCAGTTGGTGTCGCGTAAAATCGAATTCCGCTCATATTGTACGAGCGACAGTCAGATACCCTTTACTTA

Full Affymetrix probeset data:

Annotations for 1639495_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720